TkA05G351770 | RubberDandelionOmics

Gene overview

TkA05G351770

Reference: TK1151 Chr: Chr05 Coordinates: 87119234-87121127 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1360 bp · TkA05G351770|TK1151|cDNA

CTCTCCTTTCCTTTTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCATCTGTGTTGCTGTCTACTTAACATAATACCTACAGATCCTTACATCAACCATATATAGAAAGGGAACAAGGTAGGGTCAATCCAGAAAGAAGCTGGTAGGAGTAAACGTTGCCGTTTGGGTAGAAAATCTTCAAGATGGCAAAATCAGGTCGGAGTAGTGAGAAGAAGAAAAAACAAAATAACAATGGTAATATGGCGGCGTTAGGAGTTGGGG...

CDS

Download CDS FASTA

1023 bp · TkA05G351770|TK1151|CDS

ATGGCAAAATCAGGTCGGAGTAGTGAGAAGAAGAAAAAACAAAATAACAATGGTAATATGGCGGCGTTAGGAGTTGGGGTGAAGAAAGGGCCATGGACGGCTGAAGAAGACCGGAAGCTATTGGCCTACATCCAACAATTTGGCCATGGTAGTTGGCGATCTTTGCCTGCAAAAGCTGGGCTTAAGAGATGTGGAAAGAGTTGCCGGTTGAGATGGACAAATTACCTTCGACCGGATATCAAGAGAGGAAAGTTCAGTTT...

Protein

Download Protein FASTA

340 aa · TkA05G351770|TK1151|PROTEIN

MAKSGRSSEKKKKQNNNGNMAALGVGVKKGPWTAEEDRKLLAYIQQFGHGSWRSLPAKAGLKRCGKSCRLRWTNYLRPDIKRGKFSLEEERTIIQLHALLGNRWSTIAAHLPRRTDNEIKNHWNSHIKKRMTKMGIDPMTHKPKSGTQLLGSNVNHMAQWEAARLEAEARLVQKPRNNYSNQQPYNLLSPSSIHEVHKTPTTLPPPYLPCLDVLKVWQGTLWSNYSINNESLQSLISTSNVSKKNSTATSADQLRNNDPC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G351770`
TK1151 ID	TkA05G351770
OH-1004 ID	LXL04_021079
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 97.647 / OH-1004 99.104 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G351770

Location Chr05:87119234-87121127 (-)

Description Similar to MYB16: Transcription factor MYB16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g15310`	Involved in the control of epidermal cell morphogenesis in petals.	Control of cell and petal morphogenesis by R2R3 MYB transcription factors.2007 · DOI: 10.1242/dev.02836 MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri.2013 · DOI: 10.1105/tpc.113.110783 The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs.2013 · DOI: 10.4161/psb.26826
`At3g01140`	Functions as a repressor of epidermal cell outgrowth and negatively regulate trichome branch formation.	Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106.2008 · DOI: 10.1104/pp.108.126979 MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri.2013 · DOI: 10.1105/tpc.113.110783 The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs.2013 · DOI: 10.4161/psb.26826
`At3g61250`	Transcription factor that may play a role in flower development by repressing ANT.	Characterization of Arabidopsis MYB transcription factor gene AtMYB17 and its possible regulation by LEAFY and AGL15.2009 · DOI: 10.1016/s1673-8527(08)60096-x LATE MERISTEM IDENTITY2 acts together with LEAFY to activate APETALA1.2011 · DOI: 10.1242/dev.063073
`At4g28110`	Transcription factor involved in salt stress response.	AtMyb41 regulates transcriptional and metabolic responses to osmotic stress in Arabidopsis.2009 · DOI: 10.1104/pp.108.134874 Phosphorylation by AtMPK6 is required for the biological function of AtMYB41 in Arabidopsis.2012 · DOI: 10.1016/j.bbrc.2012.04.137 AtMYB41 activates ectopic suberin synthesis and assembly in multiple plant species and cell types.2014 · DOI: 10.1111/tpj.12624
`At4g05100`	Probable transcription factor that may function in salt stress response.	Salt-induced transcription factor MYB74 is regulated by the RNA-directed DNA methylation pathway in Arabidopsis.2015 · DOI: 10.1093/jxb/erv312

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021079 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000902 cell morphogenesis Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009611 response to wounding Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0010091 trichome branching Biological Process

GO:0010143 cutin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT3G01140

ath:AT3G61250

ath:AT4G21440

ath:AT4G28110

ath:AT5G15310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.922

Rank 1 · TkA05G351770 · TK1151

Cytoplasm0.164

Rank 2 · TkA05G351770 · TK1151

Cell membrane0.022

Rank 3 · TkA05G351770 · TK1151

Mitochondrion0.018

Rank 4 · TkA05G351770 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA05G351770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09111SLIDE28-55 aa

PF00249Myb_DNA-binding29-76 aa

PF15963Myb_DNA-bind_729-48 aa

PF13921Myb_DNA-bind_632-91 aa

PF23588HTH_CHD1_Hrp332-56 aa

PF09111SLIDE80-109 aa

PF00249Myb_DNA-binding82-126 aa

PF13921Myb_DNA-bind_685-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G351770	`PF09111`	SLIDE	28	55	0.089	13.5
TkA05G351770	`PF00249`	Myb_DNA-binding	29	76	4e-36	123.6
TkA05G351770	`PF15963`	Myb_DNA-bind_7	29	48	0.022	15.2
TkA05G351770	`PF13921`	Myb_DNA-bind_6	32	91	2.4e-24	86.0
TkA05G351770	`PF23588`	HTH_CHD1_Hrp3	32	56	0.00065	20.4
TkA05G351770	`PF09111`	SLIDE	80	109	0.089	13.5
TkA05G351770	`PF00249`	Myb_DNA-binding	82	126	4e-36	123.6
TkA05G351770	`PF13921`	Myb_DNA-bind_6	85	132	2.4e-24	86.0
TkA05G351770	`PF15963`	Myb_DNA-bind_7	98	134	0.022	15.2
TkA05G351770	`PF23588`	HTH_CHD1_Hrp3	149	174	0.00065	20.4
TkA05G351770	`PF13921`	Myb_DNA-bind_6	313	340	2.4e-24	86.0
TkA05G351770	`PF00249`	Myb_DNA-binding	314	336	4e-36	123.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXF1`	Arabidopsis thaliana	sp\|Q9LXF1\|MYB16_ARATH Transcription factor MYB16	68.300%	Swiss-Prot	Medium
`Q9LE63`	Arabidopsis thaliana	sp\|Q9LE63\|MY106_ARATH Transcription factor MYB106	65.000%	Swiss-Prot	Medium
`Q9M2D9`	Arabidopsis thaliana	sp\|Q9M2D9\|MYB17_ARATH Transcription factor MYB17	54.000%	Swiss-Prot	Medium
`Q9M0J5`	Arabidopsis thaliana	sp\|Q9M0J5\|MYB41_ARATH Transcription factor MYB41	73.900%	Swiss-Prot	Low
`Q9M0Y5`	Arabidopsis thaliana	sp\|Q9M0Y5\|MYB74_ARATH Transcription factor MYB74	73.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card