TkA05G135850 | RubberDandelionOmics

Gene overview

TkA05G135850

Reference: TK1151 Chr: Chr05 Coordinates: 35476107-35484691 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3543 bp · TkA05G135850|TK1151|cDNA

CCACAATTAAATACTTGGAATATATTTTAAATTTGACAATTATAACCCTTCGTTCATTTAAATACATCTGAAGTTTGACCGCATTCTAAAAAAACGCAAGACTCTGAGTTGACCTAGTTGGCTTGAATAAGTTATCCCAATTCATTTCGGATTATAAGGAAAGCCGGAGGGGTTCGGATTCAGATACAGAGTCAAGGAGTATGGAGTGTCTGATGATGATAGAAATTTGCCTGCCAGTGATCCTGTAGAAGTCGTGAAGT...

CDS

Download CDS FASTA

2163 bp · TkA05G135850|TK1151|CDS

ATGGCGGATGCTGTGGTTGAATTTCTGTTAGAGAATCTAAAACAACTGCTACTCTACAACTCGGATTTAATATATGGCGTAAAGGGCCAAGTAGATTCTCTCCATAGAGAGCTTAGTTTAATGAATGCATTCCTAAAAGACGCAAAAGAGAAACGTAACGAATATAAATACGTACGAGAATTAGTCGGACAAATCCGAGACGTGGCTTATGAAGCAGAGGACATCATCGACACATTTGTAGTAAACGCAACCATGCAGAA...

Protein

Download Protein FASTA

720 aa · TkA05G135850|TK1151|PROTEIN

MADAVVEFLLENLKQLLLYNSDLIYGVKGQVDSLHRELSLMNAFLKDAKEKRNEYKYVRELVGQIRDVAYEAEDIIDTFVVNATMQKERSTFNKIVHVFDYPTKLRSVAKDIEAIKAKMKEIYDNKMFGIEALHTPESSNKPSSSKRRKPMVEEDNVVGFDEEATEIVSRLTSNISESLEVVSVVGMGGLGKTTLAKKVFCDPVIEFHFFVRCWVYVSQEYNRKEVLVAILSSVIQPCEQIYKLNEEMLVEEIYKHLHGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G135850`
TK1151 ID	TkA05G135850
OH-1004 ID	LXL04_020101
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 95.972 / OH-1004 77.728 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G135850

Location Chr05:35476107-35484691 (+)

Description Similar to RPP8L2: Probable disease resistance RPP8-like protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50180`	Potential disease resistance protein.	No verified direct reference in this release
`At3g46730`	Potential disease resistance protein.	No verified direct reference in this release
`At3g46530`	Disease resistance protein.	RPP13 is a simple locus in Arabidopsis thaliana for alleles that specify downy mildew resistance to different avirulence determinants in Peronospora parasitica.2000 · DOI: 10.1046/j.1365-313x.2000.00664.x The Arabidopsis downy mildew resistance gene, RPP13-Nd, functions independently of NDR1 and EDS1 and does not require the accumulation of salicylic acid.2001 · DOI: 10.1094/mpmi.2001.14.3.416

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020101 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009626 plant-type hypersensitive response Biological Process

GO:0051607 defense response to virus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G53350

ath:AT5G48620

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.614

Rank 1 · TkA05G135850 · TK1151

Endoplasmic reticulum0.128

Rank 2 · TkA05G135850 · TK1151

Cytoplasm0.122

Rank 3 · TkA05G135850 · TK1151

Plastid0.065

Rank 4 · TkA05G135850 · TK1151

Lysosome / Vacuole0.064

Rank 5 · TkA05G135850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052Rx_N5-92 aa

PF25873WHD_MalT33-57 aa

PF03357Snf744-122 aa

PF18052Rx_N104-122 aa

PF13191AAA_16161-214 aa

PF00931NB-ARC166-332 aa

PF25199nSTAND_NTPase5166-202 aa

PF13173AAA_14180-277 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G135850	`PF18052`	Rx_N	5	92	5.6e-23	81.6
TkA05G135850	`PF25873`	WHD_MalT	33	57	0.062	14.2
TkA05G135850	`PF03357`	Snf7	44	122	0.3	11.4
TkA05G135850	`PF18052`	Rx_N	104	122	5.6e-23	81.6
TkA05G135850	`PF13191`	AAA_16	161	214	0.042	15.1
TkA05G135850	`PF00931`	NB-ARC	166	332	1e-43	149.6
TkA05G135850	`PF25199`	nSTAND_NTPase5	166	202	0.015	15.8
TkA05G135850	`PF13173`	AAA_14	180	277	0.07	13.9
TkA05G135850	`PF13401`	AAA_22	182	288	4.6e-06	27.7
TkA05G135850	`PF25199`	nSTAND_NTPase5	251	301	0.015	15.8
TkA05G135850	`PF23559`	WHD_DRP	418	489	1.3e-20	73.9
TkA05G135850	`PF25873`	WHD_MalT	452	496	0.062	14.2
TkA05G135850	`PF13191`	AAA_16	483	497	0.042	15.1
TkA05G135850	`PF23598`	LRR_14	537	692	5.7e-10	39.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SX38`	Arabidopsis thaliana	sp\|Q9SX38\|DRL4_ARATH Putative disease resistance protein At1g50180	35.600%	Swiss-Prot	Medium
`Q9STE7`	Arabidopsis thaliana	sp\|Q9STE7\|R13L3_ARATH Putative disease resistance RPP13-like protein 3	32.100%	Swiss-Prot	Medium
`Q9M667`	Arabidopsis thaliana	sp\|Q9M667\|RPP13_ARATH Disease resistance protein RPP13	31.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card