TkA05G112150 | RubberDandelionOmics

Gene overview

TkA05G112150

Reference: TK1151 Chr: Chr05 Coordinates: 30037420-30038943 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

876 bp · TkA05G112150|TK1151|cDNA

ATGGCAATGTGCTCTTTAAACTTGGAGATGATGGCTATGTTCAGGCTGAAGAGGGCGAGGACAGCTACATACTTGGTGCCTTATTCAACCTACCAAAACTTGCCACGTGAAGTTGAAGGATATGGGAATGAATCTGATTCCACTATATCATCTGAATTTGATGTTAATGCAACTGTTAATGAAGGTTCCACAATTCAAAACAACAAAAGATCAGAAATGAGAATGTTGGATCTTTATTCAGGATGTGGGGCCATGTCTAC...

CDS

Download CDS FASTA

876 bp · TkA05G112150|TK1151|CDS

ATGGCAATGTGCTCTTTAAACTTGGAGATGATGGCTATGTTCAGGCTGAAGAGGGCGAGGACAGCTACATACTTGGTGCCTTATTCAACCTACCAAAACTTGCCACGTGAAGTTGAAGGATATGGGAATGAATCTGATTCCACTATATCATCTGAATTTGATGTTAATGCAACTGTTAATGAAGGTTCCACAATTCAAAACAACAAAAGATCAGAAATGAGAATGTTGGATCTTTATTCAGGATGTGGGGCCATGTCTAC...

Protein

Download Protein FASTA

291 aa · TkA05G112150|TK1151|PROTEIN

MAMCSLNLEMMAMFRLKRARTATYLVPYSTYQNLPREVEGYGNESDSTISSEFDVNATVNEGSTIQNNKRSEMRMLDLYSGCGAMSTGLCLGANMANVNLVTVRNESAEDFLQLLKEWEKLCQSYSLIGGGDSQPKEEPATIEEDEEVEEEDDNDVDNVEIFEVDQILSICYGDPKEIKKRDLYLKVRWKDYGPEEDTWEPLEGLSDCHDKIKEFVIPLCFAMTINKAQGQTIQNVGIYLPEPVFSHGQLYVALSRGISR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G112150`
TK1151 ID	TkA05G112150
OH-1004 ID	LXL04_024061
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.800
Protein coverage (%)	TK1151 95.189 / OH-1004 87.937 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G112150

Location Chr05:30037420-30038943 (-)

Description Similar to CMT3: DNA (cytosine-5)-methyltransferase CMT3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69770`	Involved in the CpXpG methylation (e.g. CHG cytosine) and in gene silencing.	Requirement of CHROMOMETHYLASE3 for maintenance of CpXpG methylation.2001 · DOI: 10.1126/science.1059745 Arabidopsis cmt3 chromomethylase mutations block non-CG methylation and silencing of an endogenous gene.2001 · DOI: 10.1101/gad.905701 Genome-wide profiling of DNA methylation reveals transposon targets of CHROMOMETHYLASE3.2002 · DOI: 10.1016/s0960-9822(01)00622-4 JMJ24 targets CHROMOMETHYLASE3 for proteasomal degradation in Arabidopsis.2016 · DOI: 10.1101/gad.274647.115
`At1g80740`	May be involved in the CpXpG methylation and in gene silencing.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0226800`	Involved in CpXpG DNA methylation (By similarity).	No verified direct reference in this release
`Os10g0104900`	Involved in CpXpG DNA methylation.	No verified direct reference in this release
`UniProt: Q5KQL9`	Involved in CpXpG DNA methylation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024061 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006346 DNA methylation-dependent constitutive heterochromatin formation Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0010069 zygote asymmetric cytokinesis in embryo sac Biological Process

GO:0032259 methylation Biological Process

GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process

GO:0045814 negative regulation of gene expression, epigenetic Biological Process

GO:0141010 transposable element silencing by siRNA-mediated DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003682 chromatin binding Molecular Function

GO:0003886 DNA (cytosine-5-)-methyltransferase activity Molecular Function

GO:0031625 ubiquitin protein ligase binding Molecular Function

KEGG gene cross-reference

ath:AT1G69770

dosa:Os03g0226800

dosa:Os05g0224800

dosa:Os05g0224900

dosa:Os10g0104900

osa:4338140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.531

Rank 1 · TkA05G112150 · TK1151

Cytoplasm0.384

Rank 2 · TkA05G112150 · TK1151

Mitochondrion0.075

Rank 3 · TkA05G112150 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA05G112150 · TK1151

Extracellular0.056

Rank 5 · TkA05G112150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01443Viral_helicase123-106 aa

PF22589SPMIP1137-196 aa

PF00385Chromo162-215 aa

PF13538UvrD_C_2220-256 aa

PF02689Herpes_Helicase221-284 aa

PF01443Viral_helicase1222-256 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G112150	`PF01443`	Viral_helicase1	23	106	0.022	15.3
TkA05G112150	`PF22589`	SPMIP1	137	196	0.093	13.6
TkA05G112150	`PF00385`	Chromo	162	215	5.8e-12	46.1
TkA05G112150	`PF13538`	UvrD_C_2	220	256	0.0048	17.4
TkA05G112150	`PF02689`	Herpes_Helicase	221	284	0.00046	19.0
TkA05G112150	`PF01443`	Viral_helicase1	222	256	0.022	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94F88`	Arabidopsis thaliana	sp\|Q94F88\|CMT3_ARATH DNA (cytosine-5)-methyltransferase CMT3	43.600%	Swiss-Prot	Medium
`O49139`	Arabidopsis thaliana	sp\|O49139\|CMT1_ARATH Putative DNA (cytosine-5)-methyltransferase CMT1	36.600%	Swiss-Prot	Medium
`A0A0P0VUY4`	Oryza sativa subsp. japonica	sp\|A0A0P0VUY4\|CMT1_ORYSJ DNA (cytosine-5)-methyltransferase CMT1	39.600%	Swiss-Prot	Medium
`C0SQ89`	Oryza sativa subsp. japonica	sp\|C0SQ89\|CMT3_ORYSJ DNA (cytosine-5)-methyltransferase CMT3	38.900%	Swiss-Prot	Medium
`Q5KQL9`	Oryza sativa subsp. japonica	sp\|Q5KQL9\|CMT2_ORYSJ DNA (cytosine-5)-methyltransferase CMT2	40.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card