TkA05G100480 | RubberDandelionOmics

Gene overview

TkA05G100480

Reference: TK1151 Chr: Chr05 Coordinates: 27035533-27039167 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2115 bp · TkA05G100480|TK1151|cDNA

TCCCTGTTGTACCAACGCCTCCACACACAGACGACGCAAAACACATCCTGCTCGCCTCACACTCCCCTCCTCCTGCTCGCTGTCTCCCTCTCCTGTGACGCCGGCCGTCGCTCCACCGGAAAAGCGAACCGCAGCCGGAGGTCTTCCTACCGCCGCCTGTTCTGCTTGGTGTTGCCATCTGCTTCAGTCGCCGCTGTTCCCTTTCCTGTCGCCATCTGCTCAAGAGTTTTAATAACATCAATGGGGGTGATAAAAGATGG...

CDS

Download CDS FASTA

1887 bp · TkA05G100480|TK1151|CDS

TCCCTGTTGTACCAACGCCTCCACACACAGACGACGCAAAACACATCCTGCTCGCCTCACACTCCCCTCCTCCTGCTCGCTGTCTCCCTCTCCTGTGACGCCGGCCGTCGCTCCACCGGAAAAGCGAACCGCAGCCGGAGGTCTTCCTACCGCCGCCTGTTCTGCTTGGTGTTGCCATCTGCTTCAGTCGCCGCTGTTCCCTTTCCTGTCGCCATCTGCTCAAGAGTTTTAATAACATCAATGGGGGTGATAAAAGATGG...

Protein

Download Protein FASTA

628 aa · TkA05G100480|TK1151|PROTEIN

SLLYQRLHTQTTQNTSCSPHTPLLLLAVSLSCDAGRRSTGKANRSRRSSYRRLFCLVLPSASVAAVPFPVAICSRVLITSMGVIKDGSISGILPSNKVFGVNYPGYPSSMERAMVTLGGPEGIATARESPSNLLELRFRPEDPYSHPVHGELVPCNNFLLKISKQNIQQETSEKQEEKICADVVGHVSETYYFNGMVDYQHVLGVHADVARKKKRNWADVEPQFEKHGLIDADQEDLMILLPPLFSLKNIPENVVLKPSM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G100480`
TK1151 ID	TkA05G100480
OH-1004 ID	LXL04_017623
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	57.100
Protein coverage (%)	TK1151 12.898 / OH-1004 29.537 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G100480`
Location	Chr05:27035533-27039167 (-)
Description	Similar to HUB2: E3 ubiquitin-protein ligase BRE1-like 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017623` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006325 chromatin organization Biological Process GO:0006513 protein monoubiquitination Biological Process GO:0009908 flower development Biological Process GO:0009965 leaf morphogenesis Biological Process GO:0010162 seed dormancy process Biological Process GO:0010228 vegetative to reproductive phase transition of meristem Biological Process GO:0010389 regulation of G2/M transition of mitotic cell cycle Biological Process GO:0016567 protein ubiquitination Biological Process GO:0045087 innate immune response Biological Process GO:0050832 defense response to fungus Biological Process GO:0051301 cell division Biological Process GO:0051781 positive regulation of cell division Biological Process
KEGG gene cross-reference	ath:AT1G55250 ath:AT2G44950 dosa:Os10g0565600 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.962

Rank 1 · TkA05G100480 · TK1151

Cytoplasm0.080

Rank 2 · TkA05G100480 · TK1151

Cell membrane0.022

Rank 3 · TkA05G100480 · TK1151

Plastid0.013

Rank 4 · TkA05G100480 · TK1151

Endoplasmic reticulum0.013

Rank 5 · TkA05G100480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17682Tau95_N100-201 aa

PF09734Tau95239-389 aa

PF17682Tau95_N243-268 aa

PF05642Sporozoite_P67481-548 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G100480	`PF17682`	Tau95_N	100	201	8.1e-27	94.7
TkA05G100480	`PF09734`	Tau95	239	389	5.2e-30	105.8
TkA05G100480	`PF17682`	Tau95_N	243	268	8.1e-27	94.7
TkA05G100480	`PF05642`	Sporozoite_P67	481	548	0.43	9.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card