TkA05G058970 | RubberDandelionOmics

Gene overview

TkA05G058970

Reference: TK1151 Chr: Chr05 Coordinates: 15643878-15648093 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2645 bp · TkA05G058970|TK1151|cDNA

GTAATCCCAGTTTTTCGACGCATTCTTACGAATTGTATTTGGTTTAATTAGCAACACCCTCATTGTCTAATCTGATTATTTCATCCATCAATAGGCATCAAGGAGACACTCTTCCATCTTCTCCAAGATACAACAAAACACGCAGTTCCTAAGAAACGTTTCAATTCATCAATCCCTGATAGGTCAATTTGAAGGTTGGGTTATCAATTTTGTTATCCTCCTTCGAGATTCTTATTCATGGCAGATCAACATTCTAACAA...

CDS

Download CDS FASTA

1443 bp · TkA05G058970|TK1151|CDS

ATGGCAGATCAACATTCTAACAAAGATGCGGGTAAAGCTAATACCGTAACTGAAAGTTCCGACAAAATAGATCATCGTTCTGACGAGCATTTGGGTACAAATAATGTTCCTATCGAAAATGCGGAACCAAAAAATGTGTCAAATCAACATCCCGATAAAGCTTTGAGTACAACTAATGTTTCAGTCAAAAGTCCTGAATCGAGTGGTGTAGCAAATCAACATTCTGATAAAGGCGCGAGTATTGCCGATGTTGTTCTCGA...

Protein

Download Protein FASTA

480 aa · TkA05G058970|TK1151|PROTEIN

MADQHSNKDAGKANTVTESSDKIDHRSDEHLGTNNVPIENAEPKNVSNQHPDKALSTTNVSVKSPESSGVANQHSDKGASIADVVLESVKSEADKHPDHEGATTSNVTVEKDDSTVEINVKTLDSQLHNFNVNKNMPVSLFKKKIAGEVGLAVEHQRLIFRGKVLKDEDLLSEYHVESGHTLHLVSRHPSELQVSSSSPDADTSTTHRNTDGNEVGSSDITQVIGAVLNSFGIGGQTPIGGSQPNMQFSIPVQVAQANET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G058970`
TK1151 ID	TkA05G058970
OH-1004 ID	LXL04_019533
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.700
Protein coverage (%)	TK1151 99.375 / OH-1004 63.214 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G058970`
Location	Chr05:15643878-15648093 (+)
Description	Similar to CIP73: Ubiquitin-like domain-containing protein CIP73
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019533` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002376 immune system process Biological Process GO:0002429 immune response-activating cell surface receptor signaling pathway Biological Process GO:0002474 antigen processing and presentation of peptide antigen via MHC class I Biological Process GO:0006325 chromatin organization Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006620 post-translational protein targeting to endoplasmic reticulum membrane Biological Process GO:0007130 synaptonemal complex assembly Biological Process GO:0007283 spermatogenesis Biological Process GO:0009877 nodulation Biological Process GO:0010498 proteasomal protein catabolic process Biological Process GO:0018393 internal peptidyl-lysine acetylation Biological Process GO:0030154 cell differentiation Biological Process
KEGG gene cross-reference	hsa:7917 mmu:224727 rno:94342 ssc:100153950 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.659

Rank 1 · TkA05G058970 · TK1151

Nucleus0.388

Rank 2 · TkA05G058970 · TK1151

Endoplasmic reticulum0.077

Rank 3 · TkA05G058970 · TK1151

Cell membrane0.076

Rank 4 · TkA05G058970 · TK1151

Mitochondrion0.059

Rank 5 · TkA05G058970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05274Baculo_E2519-118 aa

PF14560Ubiquitin_2116-189 aa

PF11976Rad60-SLD117-185 aa

PF00240ubiquitin118-187 aa

PF13881Rad60-SLD_2153-198 aa

PF00240ubiquitin281-294 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G058970	`PF05274`	Baculo_E25	19	118	0.26	11.9
TkA05G058970	`PF14560`	Ubiquitin_2	116	189	0.0028	18.8
TkA05G058970	`PF11976`	Rad60-SLD	117	185	2.3e-07	31.2
TkA05G058970	`PF00240`	ubiquitin	118	187	1.3e-19	70.4
TkA05G058970	`PF13881`	Rad60-SLD_2	153	198	0.037	14.9
TkA05G058970	`PF00240`	ubiquitin	281	294	1.3e-19	70.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card