Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2262 bp · LXL04_019533|LXL04_019533|OH1004|cDNA
ATGGCAGATCAACATTCTAACAAAGATGCGGGTAAAGCTAATACCGTAACTGAAAGTTCCGACAAAATAGATCATCGTTCTGACGAGCATTTGGGTACAAATAATGTTCCTATCGAAAATGCGGAACCAAAAAATGTGTCAAATCAACATCCCGATAAAGCTTTGAGTACAACTAATGTTTCAGTCAAAAGTCCTGAATCGAGTGGTGTAGCAAATCAACATTCTGATAAAGGCGCGAGTATTGCCGATGTTGTTCTCGA...
2262 bp · LXL04_019533|LXL04_019533|OH1004|CDS
ATGGCAGATCAACATTCTAACAAAGATGCGGGTAAAGCTAATACCGTAACTGAAAGTTCCGACAAAATAGATCATCGTTCTGACGAGCATTTGGGTACAAATAATGTTCCTATCGAAAATGCGGAACCAAAAAATGTGTCAAATCAACATCCCGATAAAGCTTTGAGTACAACTAATGTTTCAGTCAAAAGTCCTGAATCGAGTGGTGTAGCAAATCAACATTCTGATAAAGGCGCGAGTATTGCCGATGTTGTTCTCGA...
Protein
Download Protein FASTA753 aa · LXL04_019533|LXL04_019533|OH1004|PROTEIN
MADQHSNKDAGKANTVTESSDKIDHRSDEHLGTNNVPIENAEPKNVSNQHPDKALSTTNVSVKSPESSGVANQHSDKGASIADVVLESVKSKADKHPDHEGATTSNVTVEKDDSTVEINVKTLDSQLHNFNVNKNMPVSLFKKKIAGEVGLAVEHQRLIFRGKVLKDEDLLSEYHVESGHTLHLVSRHPSELQVSSSSPDADTSTTHRNTDGNEGGSSDITQVIGAVLNSFGIGGQTPIGGSQPNMQFSIPVQVAQANET...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_019533 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_019533 |
|---|---|
| Location | Chr04:33145175-33148631 (+) |
| Description | Similar to CIP73: Ubiquitin-like domain-containing protein CIP73 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0002376 immune system process Biological Process GO:0002429 immune response-activating cell surface receptor signaling pathway Biological Process GO:0002474 antigen processing and presentation of peptide antigen via MHC class I Biological Process GO:0006325 chromatin organization Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006620 post-translational protein targeting to endoplasmic reticulum membrane Biological Process GO:0007130 synaptonemal complex assembly Biological Process GO:0007283 spermatogenesis Biological Process GO:0009877 nodulation Biological Process GO:0010498 proteasomal protein catabolic process Biological Process GO:0018393 internal peptidyl-lysine acetylation Biological Process GO:0030154 cell differentiation Biological Process |
| KEGG gene cross-reference | hsa:7917 mmu:224727 rno:94342 ssc:100153950 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF11976.15Rad60-SLD117-185 aaPF00240.30ubiquitin118-187 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_019533 | PF11976.15 | Rad60-SLD | 117 | 185 | 4.3e-07 | 30.4 |
| LXL04_019533 | PF00240.30 | ubiquitin | 118 | 187 | 3.7e-19 | 69.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.