TkA05G050670 | RubberDandelionOmics

Gene overview

TkA05G050670

Reference: TK1151 Chr: Chr05 Coordinates: 13500503-13506577 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3939 bp · TkA05G050670|TK1151|cDNA

GTTTGTAATAAAATGGCGTTCTAGTTATACCAGTTTTAACCGAACCTTGTCGTCATTTCGATGCATAACCCTTTATGTTTTACTAATTTATTTTTGTGTACATTACCTTGCGCCCGAGTCAACTCAATGAGTCCCATATTCCATCACACCTCAAGAAACACATCGCAACCACGTCCTGCTCAGATCAGCTCTCCCTGAACATTGCCGAAAAACCACCACCACCACCACCACCTTCCTCGTCCTCCATCTACCTCCGTCGT...

CDS

Download CDS FASTA

3201 bp · TkA05G050670|TK1151|CDS

ATGGAAGATTACCCGGAAGAAATCCGAACACCACCGGTCACACTAGTATCTATCGTCGGTCACCAAGACCTCCATGCCACGATCTCAACTCACCTCCACTCCGAACAACCGCCGATCAATACACTCGCATTGCCAGATTTTTCCAAGATCTCCGTTATAGCCAAAACCCCTAAGGAAAAAGAAAATCAATTGCCGTCAAGTTTCACTTCTAGCGGCATTCTAAAAAGAGATTGGCTCTCGAAGCATCGTACTAGGGTTCC...

Protein

Download Protein FASTA

1066 aa · TkA05G050670|TK1151|PROTEIN

MEDYPEEIRTPPVTLVSIVGHQDLHATISTHLHSEQPPINTLALPDFSKISVIAKTPKEKENQLPSSFTSSGILKRDWLSKHRTRVPAVVAALFDSDQLSGDPALWQQVCTDIENLKAVIKGRNIKLVVVVVVRFNSRDKPWSLPFRLGGIFAELAVNFYRDEGRRVKMRLEKKNYSSIEFNIRYCFKVAIYAEFRRDWVEALRMYEDGYHALREMIGTSTRLPAIQRLVEIKAVAEQLHFKISTLLLHGGKVVEAIRWF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G050670`
TK1151 ID	TkA05G050670
OH-1004 ID	LXL04_019423
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.400
Protein coverage (%)	TK1151 98.311 / OH-1004 98.107 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G050670`
Location	Chr05:13500503-13506577 (+)
Description	Similar to TRAPPC11: Trafficking protein particle complex subunit 11
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019423` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006487 protein N-linked glycosylation Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0007030 Golgi organization Biological Process GO:0009306 protein secretion Biological Process GO:0016192 vesicle-mediated transport Biological Process GO:0045054 constitutive secretory pathway Biological Process GO:0048208 COPII vesicle coating Biological Process GO:0055088 lipid homeostasis Biological Process GO:0061635 regulation of protein complex stability Biological Process GO:0099022 vesicle tethering Biological Process GO:1905897 regulation of response to endoplasmic reticulum stress Biological Process GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference	bta:537211 gga:428748 hsa:60684 mmu:320714 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.529

Rank 1 · TkA05G050670 · TK1151

Golgi apparatus0.235

Rank 2 · TkA05G050670 · TK1151

Nucleus0.225

Rank 3 · TkA05G050670 · TK1151

Endoplasmic reticulum0.137

Rank 4 · TkA05G050670 · TK1151

Lysosome / Vacuole0.109

Rank 5 · TkA05G050670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29907TRAPPC11_N71-133 aa

PF11817Foie-gras_1228-465 aa

PF22860DUF7017421-472 aa

PF28382DUF8387451-474 aa

PF30053Ig_TRAPPC11_3rd504-536 aa

PF28382DUF8387650-799 aa

PF30053Ig_TRAPPC11_3rd890-933 aa

PF12742Gryzun-like939-1033 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G050670	`PF29907`	TRAPPC11_N	71	133	1.7e-06	28.4
TkA05G050670	`PF11817`	Foie-gras_1	228	465	7.8e-48	164.1
TkA05G050670	`PF22860`	DUF7017	421	472	0.2	12.4
TkA05G050670	`PF28382`	DUF8387	451	474	1.1e-70	237.0
TkA05G050670	`PF30053`	Ig_TRAPPC11_3rd	504	536	0.033	14.7
TkA05G050670	`PF28382`	DUF8387	650	799	1.1e-70	237.0
TkA05G050670	`PF30053`	Ig_TRAPPC11_3rd	890	933	0.033	14.7
TkA05G050670	`PF12742`	Gryzun-like	939	1033	2.1e-14	54.1
TkA05G050670	`PF12584`	TRAPPC10_C	980	1023	0.055	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card