Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3489 bp · LXL04_019423|LXL04_019423|OH1004|cDNA
ATGGAAGATTACCCGGAAGAAATCCGAACACCACCGGTCACACTAGTATCTATCGTCGGTCACCAAGACCTCCATGCCACGATCTCAACTCACCTCCACTCCGAACAACCGCCGATCAATACACTCGCATTGCCAGATTTTTCCAAGATCTCCGTTATAGCCAAAACCCCTAaggaaaaagaaaatcaattgCCGTCAAGTTTCACTTCTAGCGGCATTCTAAAAAGAGATTGGCTCTCGAAGCATCGTACTAGGGTTCC...
3489 bp · LXL04_019423|LXL04_019423|OH1004|CDS
ATGGAAGATTACCCGGAAGAAATCCGAACACCACCGGTCACACTAGTATCTATCGTCGGTCACCAAGACCTCCATGCCACGATCTCAACTCACCTCCACTCCGAACAACCGCCGATCAATACACTCGCATTGCCAGATTTTTCCAAGATCTCCGTTATAGCCAAAACCCCTAAGGAAAAAGAAAATCAATTGCCGTCAAGTTTCACTTCTAGCGGCATTCTAAAAAGAGATTGGCTCTCGAAGCATCGTACTAGGGTTCC...
Protein
Download Protein FASTA1162 aa · LXL04_019423|LXL04_019423|OH1004|PROTEIN
MEDYPEEIRTPPVTLVSIVGHQDLHATISTHLHSEQPPINTLALPDFSKISVIAKTPKEKENQLPSSFTSSGILKRDWLSKHRTRVPAVVAALFDSDQLSGDPALWQQVCTDIENLKAVIKGRNIKLVVVVVVRFNSRDFITEERMVALRKRAELEAKYVLTFIPDDASELNQSLNRLGGIFAELAVNFYRDEGRRVKMRLEKKNYSSIEFNIRYCFKVAIYAEFRRDWVEALRMYEDGYHALREMIGTSTRLPAIQRLV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_019423 |
|---|---|
| TK1151 ID | TkA05G050670 |
| OH-1004 ID | LXL04_019423 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 90.400 |
| Protein coverage (%) | TK1151 98.311 / OH-1004 98.107Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_019423 |
|---|---|
| Location | Chr04:31018936-31024470 (+) |
| Description | Similar to TRAPPC11: Trafficking protein particle complex subunit 11 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006487 protein N-linked glycosylation Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0007030 Golgi organization Biological Process GO:0009306 protein secretion Biological Process GO:0016192 vesicle-mediated transport Biological Process GO:0045054 constitutive secretory pathway Biological Process GO:0048208 COPII vesicle coating Biological Process GO:0055088 lipid homeostasis Biological Process GO:0061635 regulation of protein complex stability Biological Process GO:0099022 vesicle tethering Biological Process GO:1905897 regulation of response to endoplasmic reticulum stress Biological Process GO:0005737 cytoplasm Cellular Component |
| KEGG gene cross-reference | bta:537211 gga:428748 hsa:60684 mmu:320714 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF29907.1TRAPPC11_N71-169 aaPF11817.15Foie-gras_1258-519 aaPF30303.1TRAPPC10-Trs130_NTS428-516 aaPF28382.1DUF8387744-891 aaPF12742.14Gryzun-like1031-1125 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_019423 | PF29907.1 | TRAPPC11_N | 71 | 169 | 7.5e-11 | 42.6 |
| LXL04_019423 | PF11817.15 | Foie-gras_1 | 258 | 519 | 1.2e-63 | 215.9 |
| LXL04_019423 | PF30303.1 | TRAPPC10-Trs130_NTS | 428 | 516 | 3.2e-07 | 30.6 |
| LXL04_019423 | PF28382.1 | DUF8387 | 744 | 891 | 5e-69 | 231.6 |
| LXL04_019423 | PF12742.14 | Gryzun-like | 1031 | 1125 | 2.4e-14 | 53.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.