TkA05G031260 | RubberDandelionOmics

Gene overview

TkA05G031260

Reference: TK1151 Chr: Chr05 Coordinates: 8473561-8476140 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2171 bp · TkA05G031260|TK1151|cDNA

TCTACATGTCATTTCTTACATCTCTTAAAAATAAATCAAAAAGTTTCGAGCGTTTATTTGGTCTTTCACCATGATTGTGATTTGTGGTACATTCTATTCTAGATCTATTTACCGACCTCCCTTTACCTCCAAACATTTCTCTTTAATTTAAACCTCATTGTGAATCTTTTTGCTATCGCGTTAGATTCCCCCTTTCGATTCCTTCCTCGTCATTCTTGTTCCGTCGTAACCCTAGTTTTTTTCGCAGCATTAGGGAGAAT...

CDS

Download CDS FASTA

1635 bp · TkA05G031260|TK1151|CDS

ATGGCATTTGAATGCAAATTAAGCACAGAGATTCATTCTACAGATAATTCAGAAGATACTACAGAAGTTAATTCAAATCATATTCATTCATCCGAAAAGATTTTGCTCATTGATTCAGAAACCCTAATCACCGATTCTGGAAAACCAAACTACAATCGGGCCATAACCATTCCCAGTAACACTAAATTACCTCTTCATAGAACAATTACTGACCTCCCACCTGCATTAATCTCTGAAATATTTAACTGCCTTGACCCAAA...

Protein

Download Protein FASTA

544 aa · TkA05G031260|TK1151|PROTEIN

MAFECKLSTEIHSTDNSEDTTEVNSNHIHSSEKILLIDSETLITDSGKPNYNRAITIPSNTKLPLHRTITDLPPALISEIFNCLDPKELGVVSCVNPSLYQIASDHHVWKQFYCERWGLPAAAPGRPSPDFSGEKSWKELFVEREFHSKTFMGRYTMETLYGHTETVRTVFLLPSKKLVFTSGYDSVVRMWDMEDGISISTSRPLGCTIRALSADSKLLIAGGSDGFIHGWRAEEGHPRLFDMNGCDRNRNQNRNRNHEF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G031260`
TK1151 ID	TkA05G031260
OH-1004 ID	LXL04_033958
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	22.900
Protein coverage (%)	TK1151 47.978 / OH-1004 68.983 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G031260

Location Chr05:8473561-8476140 (-)

Description Similar to JGB: Protein JINGUBANG

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g21040`	F-box/WD-40 repeat-containing protein At5g21040.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033958 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000132 establishment of mitotic spindle orientation Biological Process

GO:0000209 protein polyubiquitination Biological Process

GO:0000281 mitotic cytokinesis Biological Process

GO:0006470 protein dephosphorylation Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006935 chemotaxis Biological Process

GO:0007097 nuclear migration Biological Process

GO:0007281 germ cell development Biological Process

GO:0009846 pollen germination Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031023 microtubule organizing center organization Biological Process

KEGG gene cross-reference

ath:AT2G26490

ddi:DDB_G0290687

mmu:103583

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.655

Rank 1 · TkA05G031260 · TK1151

Cytoplasm0.315

Rank 2 · TkA05G031260 · TK1151

Cell membrane0.044

Rank 3 · TkA05G031260 · TK1151

Mitochondrion0.041

Rank 4 · TkA05G031260 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA05G031260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937F-box-like69-114 aa

PF00646F-box69-110 aa

PF25173Beta-prop_WDR3_1st156-232 aa

PF25174Beta-prop_THOC3156-237 aa

PF25175Beta-prop_WDR5156-237 aa

PF23381Beta-prop_IFT122_1st157-235 aa

PF24817WD40_WDHD1_1st157-199 aa

PF24814WD40_Prp19157-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G031260	`PF12937`	F-box-like	69	114	5.5e-09	36.4
TkA05G031260	`PF00646`	F-box	69	110	4.3e-08	33.4
TkA05G031260	`PF25173`	Beta-prop_WDR3_1st	156	232	2.7e-25	89.9
TkA05G031260	`PF25174`	Beta-prop_THOC3	156	237	2e-23	83.5
TkA05G031260	`PF25175`	Beta-prop_WDR5	156	237	3.5e-21	76.5
TkA05G031260	`PF23381`	Beta-prop_IFT122_1st	157	235	8.5e-22	78.5
TkA05G031260	`PF24817`	WD40_WDHD1_1st	157	199	3.8e-18	66.4
TkA05G031260	`PF24814`	WD40_Prp19	157	229	6.4e-17	62.2
TkA05G031260	`PF24807`	WD40_CDC20-Fz	157	237	9.2e-16	58.7
TkA05G031260	`PF23869`	Beta-prop_WDR75_1st	157	213	1.3e-07	32.0
TkA05G031260	`PF25168`	Beta-prop_WDR36-Utp21_2nd	157	199	1.5e-05	25.1
TkA05G031260	`PF23342`	WDR90_beta-prop_4th	157	194	0.014	15.2
TkA05G031260	`PF00400`	WD40	158	192	1.5e-29	101.8
TkA05G031260	`PF24805`	EIF3I	158	202	1.2e-06	28.7
TkA05G031260	`PF25499`	Beta-prop_pof12	158	203	5.3e-05	23.0
TkA05G031260	`PF25172`	Beta-prop_WDR3_2nd	159	233	3.7e-14	53.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AD8`	Arabidopsis thaliana	sp\|Q94AD8\|FBW3_ARATH F-box/WD-40 repeat-containing protein At5g21040	61.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card