TkA05G015110 | RubberDandelionOmics

Gene overview

TkA05G015110

Reference: TK1151 Chr: Chr05 Coordinates: 4245970-4249916 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2250 bp · TkA05G015110|TK1151|cDNA

TTGAAATCTGACAGCTCGCTCCCGTCCCCATTGTTTGGCCTCTGCTTCCCCTGAAATAGTGAGAGCTTCAGTCATTTGGAAAGAGAAAAACATCATTCTAGAGAGAGAAATTGATCTCGTTTCTCTTCTCTGAGTTTGATTTTTAGTTCGTCATCAAGCAGATAAGGTTAACATTTATGGCAAGTAATTACTTCGGTGTTTTGGTATCAGATCCATGGCTACAGAATCAATTTACACAAGTCGAGCTTCGGAGCTTAAAA...

CDS

Download CDS FASTA

1989 bp · TkA05G015110|TK1151|CDS

ATGGCAAGTAATTACTTCGGTGTTTTGGTATCAGATCCATGGCTACAGAATCAATTTACACAAGTCGAGCTTCGGAGCTTAAAATCTTATTTTCTGACGATGAGGAGGGAAAGTGGAAGTCTCACGCTTGGTGATTTGCCATCGAAAATGTCCAAACTGAAAAACGTTGGAGAGAATCTTACCGAGGAAGAACGAGCTGCGTTTCTTCACGATTCTTATCAAAATTTAGGCGATGAAGTTGATTTCGAACTTTTTCTTCG...

Protein

Download Protein FASTA

662 aa · TkA05G015110|TK1151|PROTEIN

MASNYFGVLVSDPWLQNQFTQVELRSLKSYFLTMRRESGSLTLGDLPSKMSKLKNVGENLTEEERAAFLHDSYQNLGDEVDFELFLRVYLNLQSHATSRMGKGAKTSSAFLKSPTSTLLHTISESEKASYVGHINNYLGEDTFLKKFLPIDPSTNDLFEVAKDGVLICKLINVAVPGTIDERAINTKTVLNPWERNENHTLCLNSAKAIGCTVVNIGTQDFIEGRRHLVLGVISQIIKIQLLADLDLKKTPQLVELVGDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G015110`
TK1151 ID	TkA05G015110
OH-1004 ID	LXL04_019051
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G015110

Location Chr05:4245970-4249916 (+)

Description Similar to FIM2: Fimbrin-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g48460`	Cross-links actin filaments (F-actin).	No verified direct reference in this release
`At5g35700`	Cross-links actin filaments (F-actin) in a calcium independent manner.	Arabidopsis FIMBRIN5, an actin bundling factor, is required for pollen germination and pollen tube growth.2010 · DOI: 10.1105/tpc.110.080283
`At4g26700`	Cross-links actin filaments (F-actin) in a calcium independent manner.	AtFim1 is an actin filament crosslinking protein from Arabidopsis thaliana.2000 · DOI: 10.1046/j.1365-313x.2000.00907.x Fluorescently-labeled fimbrin decorates a dynamic actin filament network in live plant cells.2001 · DOI: 10.1007/s004250000494
`At5g55400`	Cross-links actin filaments (F-actin).	No verified direct reference in this release
`At2g04750`	Cross-links actin filaments (F-actin).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019051 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007623 circadian rhythm Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0030036 actin cytoskeleton organization Biological Process

GO:0051017 actin filament bundle assembly Biological Process

GO:0051639 actin filament network formation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005884 actin filament Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0032432 actin filament bundle Cellular Component

KEGG gene cross-reference

ath:AT2G04750

ath:AT4G26700

ath:AT5G35700

ath:AT5G48460

ath:AT5G55400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.602

Rank 1 · TkA05G015110 · TK1151

Cell membrane0.218

Rank 2 · TkA05G015110 · TK1151

Nucleus0.159

Rank 3 · TkA05G015110 · TK1151

Golgi apparatus0.146

Rank 4 · TkA05G015110 · TK1151

Lysosome / Vacuole0.095

Rank 5 · TkA05G015110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28809FtsQ_DivIB_C_rel8-56 aa

PF28809FtsQ_DivIB_C_rel123-147 aa

PF06294CH_2148-180 aa

PF11971CAMSAP_CH149-190 aa

PF00307CH152-238 aa

PF00307CH270-371 aa

PF06294CH_2276-316 aa

PF11971CAMSAP_CH288-315 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G015110	`PF28809`	FtsQ_DivIB_C_rel	8	56	0.18	12.9
TkA05G015110	`PF28809`	FtsQ_DivIB_C_rel	123	147	0.18	12.9
TkA05G015110	`PF06294`	CH_2	148	180	2e-07	31.6
TkA05G015110	`PF11971`	CAMSAP_CH	149	190	3.8e-08	33.8
TkA05G015110	`PF00307`	CH	152	238	1.4e-82	273.7
TkA05G015110	`PF00307`	CH	270	371	1.4e-82	273.7
TkA05G015110	`PF06294`	CH_2	276	316	2e-07	31.6
TkA05G015110	`PF11971`	CAMSAP_CH	288	315	3.8e-08	33.8
TkA05G015110	`PF00307`	CH	396	498	1.4e-82	273.7
TkA05G015110	`PF06294`	CH_2	403	496	2e-07	31.6
TkA05G015110	`PF11971`	CAMSAP_CH	410	474	3.8e-08	33.8
TkA05G015110	`PF00307`	CH	519	622	1.4e-82	273.7
TkA05G015110	`PF06294`	CH_2	543	594	2e-07	31.6
TkA05G015110	`PF11971`	CAMSAP_CH	544	587	3.8e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O50064`	Arabidopsis thaliana	sp\|O50064\|FIMB2_ARATH Fimbrin-2	77.400%	Swiss-Prot	High
`Q9FKI0`	Arabidopsis thaliana	sp\|Q9FKI0\|FIMB5_ARATH Fimbrin-5	68.200%	Swiss-Prot	High
`Q7G188`	Arabidopsis thaliana	sp\|Q7G188\|FIMB1_ARATH Fimbrin-1	68.300%	Swiss-Prot	High
`Q9FJ70`	Arabidopsis thaliana	sp\|Q9FJ70\|FIMB3_ARATH Fimbrin-3	67.600%	Swiss-Prot	High
`Q9SJ84`	Arabidopsis thaliana	sp\|Q9SJ84\|FIMB4_ARATH Fimbrin-4	66.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card