TkA05G006070 | RubberDandelionOmics

Gene overview

TkA05G006070

Reference: TK1151 Chr: Chr05 Coordinates: 1831516-1835141 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1408 bp · TkA05G006070|TK1151|cDNA

ATGGAAAGTCGGATGGTGCTACACGCGCCTGATGAAGTTATTACCGAGCTTACCGGTGCCGACACTGAGTTAGTGAGCAGATCATGGAACTTATTTGCTATTCTGCTATCCATGGGGCATCCAGTTCTTCCTATTGAACTGGAATCTCGATGCACTTCTTTTAAAGTGTCAACCGAATTTGTCGAATTCGTTTGCTCTATACCTAACTCTCCCCTCTCGCTGACGGATGATGGTTTGGTTACGATTTATTCTGCTGTTTG...

CDS

Download CDS FASTA

1308 bp · TkA05G006070|TK1151|CDS

ATGGAAAGTCGGATGGTGCTACACGCGCCTGATGAAGTTATTACCGAGCTTACCGGTGCCGACACTGAGTTAGTGAGCAGATCATGGAACTTATTTGCTATTCTGCTATCCATGGGGCATCCAGTTCTTCCTATTGAACTGGAATCTCGATGCACTTCTTTTAAAGTGTCAACCGAATTTGTCGAATTCGTTTGCTCTATACCTAACTCTCCCCTCTCGCTGACGGATGATGGTTTGGTTACGATTTATTCTGCTGTTTG...

Protein

Download Protein FASTA

435 aa · TkA05G006070|TK1151|PROTEIN

MESRMVLHAPDEVITELTGADTELVSRSWNLFAILLSMGHPVLPIELESRCTSFKVSTEFVEFVCSIPNSPLSLTDDGLVTIYSAVCMRLQRFLLSSGRLFKISIPREIETRDCERKRACGDVELMYYRKRKRSRPNISDNADQTALAMLVRISDAFEKFACLLNLFIHIELSHSCACYVMHIEVTDTVCSADSDGLNGFANAGDDQEFGTSGVYGFKFIPRSSPTHTLPRWNSEQTSCVITEEALTALASVADSSQEQF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G006070`
TK1151 ID	TkA05G006070
OH-1004 ID	LXL04_018970
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G006070`
Location	Chr05:1831516-1835141 (+)
Description	Similar to sal3: Importin subunit beta-3 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018970` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002753 cytoplasmic pattern recognition receptor signaling pathway Biological Process GO:0006606 protein import into nucleus Biological Process GO:0006607 NLS-bearing protein import into nucleus Biological Process GO:0006610 ribosomal protein import into nucleus Biological Process GO:0042307 positive regulation of protein import into nucleus Biological Process GO:0045786 negative regulation of cell cycle Biological Process GO:0071230 cellular response to amino acid stimulus Biological Process GO:0005634 nucleus Cellular Component GO:0005635 nuclear envelope Cellular Component GO:0005643 nuclear pore Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component
KEGG gene cross-reference	hsa:26953 hsa:3843 mmu:240614 mmu:70572 spo:2539387 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.469

Rank 1 · TkA05G006070 · TK1151

Cytoplasm0.437

Rank 2 · TkA05G006070 · TK1151

Mitochondrion0.098

Rank 3 · TkA05G006070 · TK1151

Cell membrane0.078

Rank 4 · TkA05G006070 · TK1151

Endoplasmic reticulum0.071

Rank 5 · TkA05G006070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25574TPR_IMB1234-361 aa

PF25780TPR_IPO5240-339 aa

PF09361Phasin_2242-322 aa

PF13513HEAT_EZ243-294 aa

PF05004IFRD256-332 aa

PF13513HEAT_EZ286-326 aa

PF25574TPR_IMB1388-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G006070	`PF25574`	TPR_IMB1	234	361	2.6e-09	37.0
TkA05G006070	`PF25780`	TPR_IPO5	240	339	0.13	13.3
TkA05G006070	`PF09361`	Phasin_2	242	322	0.022	15.7
TkA05G006070	`PF13513`	HEAT_EZ	243	294	0.0038	18.5
TkA05G006070	`PF05004`	IFRD	256	332	0.0027	17.4
TkA05G006070	`PF13513`	HEAT_EZ	286	326	0.0038	18.5
TkA05G006070	`PF25574`	TPR_IMB1	388	418	2.6e-09	37.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card