Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3357 bp · TkA05G005170|TK1151|cDNA
GGGAGGTTCTGGTCCAATAACAAAGAATCCTGAATTAACGATGAGCACATCATCTAGACATCTACTGTTTATTACTCCATTTGCGGTTCCTTTTACGAATGCGCATTGGACACGACACATTACATTACACATCAATCAAAGATTCCATCGTCATGCGCCTACACAAAGTCTATCACCGCTTCTCTCTCTTTTCCCTCACTTCGCCCCCTTTTCTTCTTCCTCCATCTTCAACCTTCTTCTCTTCTTATTCCCCCTCTTCC...
2883 bp · TkA05G005170|TK1151|CDS
ATGCGCATTGGACACGACACATTACATTACACATCAATCAAAGATTCCATCGTCATGCGCCTACACAAAGTCTATCACCGCTTCTCTCTCTTTTCCCTCACTTCGCCCCCTTTTCTTCTTCCTCCATCTTCAACCTTCTTCTCTTCTTATTCCCCCTCTTCCAAAAGCTGTCGAATTTCATCATCATCAACGCCTTCCACCCCCAAGCCTTTTCTCCAAACCATGTCTACCTCAAGATTACACAATCTGGTCCCTGTTGC...
Protein
Download Protein FASTA960 aa · TkA05G005170|TK1151|PROTEIN
MRIGHDTLHYTSIKDSIVMRLHKVYHRFSLFSLTSPPFLLPPSSTFFSSYSPSSKSCRISSSSTPSTPKPFLQTMSTSRLHNLVPVAAIATEDAAGPNGSTASPEDDELDSGYRLPPAEIRDIVDAPPLPALSFSPQRDKILFLKRRSLPPLSELAKPEDKLAGVRIDGKSNTRSRMSFYTGIGIHDLRDDGTLGPEKLIHGFPAGSKLNFVTWSTDGRHLAFSIRQDQDDDGGSKLRVWVADVETGKAKPLFQSPDVFL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G005170 |
|---|---|
| TK1151 ID | TkA05G005170 |
| OH-1004 ID | LXL04_018948 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.500 |
| Protein coverage (%) | TK1151 98.125 / OH-1004 96.327Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G005170 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr05:1522651-1527154 (+) | ||||||||||||
| Description | Similar to GEP: Probable glutamyl endopeptidase, chloroplastic | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006508 proteolysis Biological Process GO:0043171 peptide catabolic process Biological Process GO:0051603 proteolysis involved in protein catabolic process Biological Process GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0004175 endopeptidase activity Molecular Function GO:0004177 aminopeptidase activity Molecular Function GO:0004252 serine-type endopeptidase activity Molecular Function GO:0008239 dipeptidyl-peptidase activity Molecular Function GO:0042277 peptide binding Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT2G47390 cel:CELE_F44B9.1 dosa:Os03g0307100 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00561Abhydrolase_1199-209 aaPF02897Peptidase_S9_N210-286 aaPF02897Peptidase_S9_N472-592 aaPF02129Peptidase_S15601-639 aaPF02129Peptidase_S15664-808 aaPF00756Esterase668-691 aaPF01738DLH750-899 aaPF12146Hydrolase_4752-809 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA05G005170 | PF00561 | Abhydrolase_1 | 199 | 209 | 0.0098 | 16.3 |
| TkA05G005170 | PF02897 | Peptidase_S9_N | 210 | 286 | 0.0011 | 18.6 |
| TkA05G005170 | PF02897 | Peptidase_S9_N | 472 | 592 | 0.0011 | 18.6 |
| TkA05G005170 | PF02129 | Peptidase_S15 | 601 | 639 | 0.00011 | 22.8 |
| TkA05G005170 | PF02129 | Peptidase_S15 | 664 | 808 | 0.00011 | 22.8 |
| TkA05G005170 | PF00756 | Esterase | 668 | 691 | 0.0096 | 16.4 |
| TkA05G005170 | PF01738 | DLH | 750 | 899 | 0.0048 | 17.2 |
| TkA05G005170 | PF12146 | Hydrolase_4 | 752 | 809 | 0.0017 | 18.4 |
| TkA05G005170 | PF02230 | Abhydrolase_2 | 752 | 810 | 0.01 | 16.4 |
| TkA05G005170 | PF10230 | LIDHydrolase | 756 | 797 | 0.36 | 11.2 |
| TkA05G005170 | PF00326 | Peptidase_S9 | 759 | 912 | 7.5e-23 | 81.9 |
| TkA05G005170 | PF12697 | Abhydrolase_6 | 761 | 914 | 0.00013 | 23.3 |
| TkA05G005170 | PF00756 | Esterase | 773 | 861 | 0.0096 | 16.4 |
| TkA05G005170 | PF00561 | Abhydrolase_1 | 774 | 824 | 0.0098 | 16.3 |
| TkA05G005170 | PF00561 | Abhydrolase_1 | 821 | 858 | 0.0098 | 16.3 |
| TkA05G005170 | PF02129 | Peptidase_S15 | 829 | 886 | 0.00011 | 22.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.