TkA05G001950 | RubberDandelionOmics

Gene overview

TkA05G001950

Reference: TK1151 Chr: Chr05 Coordinates: 543964-545235 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

609 bp · TkA05G001950|TK1151|cDNA

ATGTCACACAATGAATTCACCTTCAAGTTAATAAATGGAGTTCTTTCAGATTTCAACAAAATCTTCAAATACAAATTTGTTCATTTAGGAGGACACGAAGTTGACACCAGTAGCTGGAGTGCCACTCCCTATATAAAAAAGTGGTTAGAACAAAAAGGATTTAACGAATCCCAAGCATACGAATACTTTGAGGAAACTTTCAACAACTTTGGTAGTAAACTTGACAGAAAAAACGGGGTTCATAACTGGCTTTGGAGTGG...

CDS

Download CDS FASTA

609 bp · TkA05G001950|TK1151|CDS

ATGTCACACAATGAATTCACCTTCAAGTTAATAAATGGAGTTCTTTCAGATTTCAACAAAATCTTCAAATACAAATTTGTTCATTTAGGAGGACACGAAGTTGACACCAGTAGCTGGAGTGCCACTCCCTATATAAAAAAGTGGTTAGAACAAAAAGGATTTAACGAATCCCAAGCATACGAATACTTTGAGGAAACTTTCAACAACTTTGGTAGTAAACTTGACAGAAAAAACGGGGTTCATAACTGGCTTTGGAGTGG...

Protein

Download Protein FASTA

202 aa · TkA05G001950|TK1151|PROTEIN

MSHNEFTFKLINGVLSDFNKIFKYKFVHLGGHEVDTSSWSATPYIKKWLEQKGFNESQAYEYFEETFNNFGSKLDRKNGVHNWLWSGVAMKVVESRLREVVDKCWEACKYSSINYRFSKQKFQIRNLEADNWFKVHPELESRNSIPKPLICPSKKGSCGCTRFQLLEGNKVCHDYQEIKIQESTQVLGVGVEGFYYNAHDFE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G001950`
TK1151 ID	TkA05G001950
OH-1004 ID	LXL04_018862
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	86.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G001950

Location Chr05:543964-545235 (+)

Description Similar to HEXO3: Beta-hexosaminidase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65590`	Has a broad substrate specificity.	Biosynthesis of truncated N-linked oligosaccharides results from non-orthologous hexosaminidase-mediated mechanisms in nematodes, plants, and insects.2007 · DOI: 10.1074/jbc.m704235200 Enzymatic properties and subcellular localization of Arabidopsis beta-N-acetylhexosaminidases.2007 · DOI: 10.1104/pp.107.101162 Beta-N-acetylhexosaminidases HEXO1 and HEXO3 are responsible for the formation of paucimannosidic N-glycans in Arabidopsis thaliana.2011 · DOI: 10.1074/jbc.m110.178020
`At2g14050`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8B406`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release
`Os06g0218500`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018862 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006260 DNA replication Biological Process

GO:0006491 N-glycan processing Biological Process

GO:0030203 glycosaminoglycan metabolic process Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G65590

ath:AT2G14050

ath:AT3G55260

dosa:Os06g0218500

osa:4340503

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.321

Rank 1 · TkA05G001950 · TK1151

Extracellular0.289

Rank 2 · TkA05G001950 · TK1151

Nucleus0.161

Rank 3 · TkA05G001950 · TK1151

Endoplasmic reticulum0.079

Rank 4 · TkA05G001950 · TK1151

Mitochondrion0.079

Rank 5 · TkA05G001950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00728Glyco_hydro_204-110 aa

PF18735HEPN_RiboL-PSP6-72 aa

PF18735HEPN_RiboL-PSP108-125 aa

PF17207MCM_OB112-190 aa

PF07610DUF1573117-165 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G001950	`PF00728`	Glyco_hydro_20	4	110	1.1e-10	42.1
TkA05G001950	`PF18735`	HEPN_RiboL-PSP	6	72	0.37	11.4
TkA05G001950	`PF18735`	HEPN_RiboL-PSP	108	125	0.37	11.4
TkA05G001950	`PF17207`	MCM_OB	112	190	0.00025	21.5
TkA05G001950	`PF07610`	DUF1573	117	165	0.018	15.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L7S6`	Arabidopsis thaliana	sp\|Q8L7S6\|HEXO3_ARATH Beta-hexosaminidase 3	51.700%	Swiss-Prot	Low
`F4IFF3`	Arabidopsis thaliana	sp\|F4IFF3\|MCM9_ARATH Probable DNA helicase MCM9	52.900%	Swiss-Prot	Low
`B8B406`	Oryza sativa subsp. indica	sp\|B8B406\|MCM9_ORYSI Probable DNA helicase MCM9	52.100%	Swiss-Prot	Low
`Q69QA6`	Oryza sativa subsp. japonica	sp\|Q69QA6\|MCM9_ORYSJ DNA helicase MCM9	52.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card