LXL04_018862 | RubberDandelionOmics

Gene overview

LXL04_018862

Reference: OH-1004 Chr: Chr04 Coordinates: 19314556-19315828 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

690 bp · LXL04_018862|LXL04_018862|OH1004|cDNA

ATGTCACACAATGAATTCACCTTCAAGTTAATAAATGGAGTTCTTTCAGATTTCAACAAAATCTTCAAATACAAATTTGTTCATTTAGGAGGACACGAAGTTGACACCAGTAGCTGGAGTGCCACTCCCTATATAAAAAAGTGGTTAGAACAAAAAGGATTTAACGAATCCCAAGCATACGAATACTTTGAGGAAACTTTCAACAACTTTGGTAGTAAACTTGACAGAAAAAACGGGGTTCATAACTGGCTTTGGAGTGG...

CDS

Download CDS FASTA

690 bp · LXL04_018862|LXL04_018862|OH1004|CDS

ATGTCACACAATGAATTCACCTTCAAGTTAATAAATGGAGTTCTTTCAGATTTCAACAAAATCTTCAAATACAAATTTGTTCATTTAGGAGGACACGAAGTTGACACCAGTAGCTGGAGTGCCACTCCCTATATAAAAAAGTGGTTAGAACAAAAAGGATTTAACGAATCCCAAGCATACGAATACTTTGAGGAAACTTTCAACAACTTTGGTAGTAAACTTGACAGAAAAAACGGGGTTCATAACTGGCTTTGGAGTGG...

Protein

Download Protein FASTA

229 aa · LXL04_018862|LXL04_018862|OH1004|PROTEIN

MSHNEFTFKLINGVLSDFNKIFKYKFVHLGGHEVDTSSWSATPYIKKWLEQKGFNESQAYEYFEETFNNFGSKLDRKNGVHNWLWSGVAKKVVESRLREVVDKCWEACKYSSINYRFSKQKFQIRILEADNWFKVHPELESRNSIPKPLICPSKVIFHSLLLPVISIQNYKLPLYLLSSIQKSSCGCTRFQLLEGNKVCHDYQEIKIQESTQVLGVGVEGFYYNAHDFE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018862`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018862

Location Chr04:19314556-19315828 (+)

Description Similar to HEXO3: Beta-hexosaminidase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65590`	Has a broad substrate specificity.	Biosynthesis of truncated N-linked oligosaccharides results from non-orthologous hexosaminidase-mediated mechanisms in nematodes, plants, and insects.2007 · DOI: 10.1074/jbc.m704235200 Enzymatic properties and subcellular localization of Arabidopsis beta-N-acetylhexosaminidases.2007 · DOI: 10.1104/pp.107.101162 Beta-N-acetylhexosaminidases HEXO1 and HEXO3 are responsible for the formation of paucimannosidic N-glycans in Arabidopsis thaliana.2011 · DOI: 10.1074/jbc.m110.178020
`At3g55260`	Has a broad substrate specificity.	Biosynthesis of truncated N-linked oligosaccharides results from non-orthologous hexosaminidase-mediated mechanisms in nematodes, plants, and insects.2007 · DOI: 10.1074/jbc.m704235200 Enzymatic properties and subcellular localization of Arabidopsis beta-N-acetylhexosaminidases.2007 · DOI: 10.1104/pp.107.101162 Beta-N-acetylhexosaminidases HEXO1 and HEXO3 are responsible for the formation of paucimannosidic N-glycans in Arabidopsis thaliana.2011 · DOI: 10.1074/jbc.m110.178020
`At2g14050`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0218500`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release
`UniProt: B8B406`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018862 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006260 DNA replication Biological Process

GO:0006491 N-glycan processing Biological Process

GO:0030203 glycosaminoglycan metabolic process Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G65590

ath:AT2G14050

ath:AT3G55260

dosa:Os06g0218500

osa:4340503

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.412

Rank 1 · LXL04_018862 · OH-1004

Nucleus0.246

Rank 2 · LXL04_018862 · OH-1004

Mitochondrion0.134

Rank 3 · LXL04_018862 · OH-1004

Extracellular0.110

Rank 4 · LXL04_018862 · OH-1004

Endoplasmic reticulum0.089

Rank 5 · LXL04_018862 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00728.29Glyco_hydro_204-111 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018862	`PF00728.29`	Glyco_hydro_20	4	111	3.6e-11	43.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L7S6`	Arabidopsis thaliana	Beta-hexosaminidase 3	51.724%	Swiss-Prot	weak database homology
`A7WM73`	Arabidopsis thaliana	Beta-hexosaminidase 1	37.838%	Swiss-Prot	weak database homology
`F4IFF3`	Arabidopsis thaliana	Probable DNA helicase MCM9	30.058%	Swiss-Prot	moderate database homology
`Q69QA6`	Oryza sativa subsp. japonica	DNA helicase MCM9	41.176%	Swiss-Prot	weak database homology
`B8B406`	Oryza sativa subsp. indica	Probable DNA helicase MCM9	41.176%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card