TkA04G486590 | RubberDandelionOmics

Gene overview

TkA04G486590

Reference: TK1151 Chr: Chr04 Coordinates: 122956622-122957455 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

804 bp · TkA04G486590|TK1151|cDNA

ATGAAGAAAGAACTCGAAGAATACATGGATTACGACATCGGGTCGTTTTGCAAAGACGATTGGAACGTCGCCCAAAATCTCATGATCAAGGGTTGCGATCCATTACCAAGAAGAAGATGTCTCACAAGAGCTTCAAAGCTTTACCAAAAACCCTACCCGATAAACGAATCTTTATGGCGGGTACCCGATGGGCGAAACGTAAGATGGAGTCGGTACGCGTGTAGAAATTTCGAGTGCTTAAGTAGCACAGGGTGTTTTGA...

CDS

Download CDS FASTA

804 bp · TkA04G486590|TK1151|CDS

ATGAAGAAAGAACTCGAAGAATACATGGATTACGACATCGGGTCGTTTTGCAAAGACGATTGGAACGTCGCCCAAAATCTCATGATCAAGGGTTGCGATCCATTACCAAGAAGAAGATGTCTCACAAGAGCTTCAAAGCTTTACCAAAAACCCTACCCGATAAACGAATCTTTATGGCGGGTACCCGATGGGCGAAACGTAAGATGGAGTCGGTACGCGTGTAGAAATTTCGAGTGCTTAAGTAGCACAGGGTGTTTTGA...

Protein

Download Protein FASTA

267 aa · TkA04G486590|TK1151|PROTEIN

MKKELEEYMDYDIGSFCKDDWNVAQNLMIKGCDPLPRRRCLTRASKLYQKPYPINESLWRVPDGRNVRWSRYACRNFECLSSTGCFEMEKEKVKWVINTTVLTDFLIKDVLGVKPGEIRVGIDFGIGTGSFAARMREHNVTIVSTALNLGAPFNEMIALRGLIPLYVTLNQRLPFFDNTMDLIHTTGFMDGWIDLQLMDFILFDWDRVLRPGGLLWVDRFFCNRKDLDDYMYMFLQFRYKKYKWAISSKSKDEVFLSALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G486590`
TK1151 ID	TkA04G486590
OH-1004 ID	LXL04_026688
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	57.900
Protein coverage (%)	TK1151 74.532 / OH-1004 24.270 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G486590

Location Chr04:122956622-122957455 (-)

Description Similar to ATL68: RING-H2 finger protein ATL68

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29790`	Probable methyltransferase At1g29790.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026688 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009269 response to desiccation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0071465 cellular response to desiccation Biological Process

GO:1902075 cellular response to salt Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT2G46160

ath:AT3G61550

ghi:107922715

gmx:547837

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.466

Rank 1 · TkA04G486590 · TK1151

Extracellular0.176

Rank 2 · TkA04G486590 · TK1151

Endoplasmic reticulum0.092

Rank 3 · TkA04G486590 · TK1151

Lysosome / Vacuole0.064

Rank 4 · TkA04G486590 · TK1151

Cell membrane0.059

Rank 5 · TkA04G486590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25901DUF796015-39 aa

PF03141Methyltransf_29114-215 aa

PF08242Methyltransf_12122-215 aa

PF08241Methyltransf_11123-216 aa

PF13649Methyltransf_25123-213 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G486590	`PF25901`	DUF7960	15	39	0.33	11.7
TkA04G486590	`PF03141`	Methyltransf_29	114	215	9.8e-08	31.7
TkA04G486590	`PF08242`	Methyltransf_12	122	215	0.051	15.0
TkA04G486590	`PF08241`	Methyltransf_11	123	216	8.2e-05	23.9
TkA04G486590	`PF13649`	Methyltransf_25	123	213	0.0079	17.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWB7`	Arabidopsis thaliana	sp\|Q8RWB7\|PMT12_ARATH Probable methyltransferase At1g29790	42.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card