TkA04G480260 | RubberDandelionOmics

Gene overview

TkA04G480260

Reference: TK1151 Chr: Chr04 Coordinates: 121320938-121326547 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3618 bp · TkA04G480260|TK1151|cDNA

ATGCTGATAAAATATCTATTCAAGTATATATCCAAAGGTGTTGATCGTATATCTTTCGCCATTCGTAAGGCTGAATTGCACTCTACTCAAGCATCGTCTTCTACACTTATTGAGGTAGACGAAATCCAGAATTTTATTGATGGTCGTTATGTTTGTGCTCATGAAGCTGCGTGGCGAATATTTAATTACTTTATCCATGAGCGTTGGCCTGCTGTCCAGATTTTAGTTGTACATCTACGTGACATGCAGGCAACTAGATT...

CDS

Download CDS FASTA

3618 bp · TkA04G480260|TK1151|CDS

ATGCTGATAAAATATCTATTCAAGTATATATCCAAAGGTGTTGATCGTATATCTTTCGCCATTCGTAAGGCTGAATTGCACTCTACTCAAGCATCGTCTTCTACACTTATTGAGGTAGACGAAATCCAGAATTTTATTGATGGTCGTTATGTTTGTGCTCATGAAGCTGCGTGGCGAATATTTAATTACTTTATCCATGAGCGTTGGCCTGCTGTCCAGATTTTAGTTGTACATCTACGTGACATGCAGGCAACTAGATT...

Protein

Download Protein FASTA

1205 aa · TkA04G480260|TK1151|PROTEIN

MLIKYLFKYISKGVDRISFAIRKAELHSTQASSSTLIEVDEIQNFIDGRYVCAHEAAWRIFNYFIHERWPAVQILVVHLRDMQATRFEDSSRLANVVRNPNFGRTTLTAWFEYNRNGSDGRHLIYSEFPYLYRWEARTREWVQRRRDFSLAVGRMVYVHPTSGELFYLRMLLSHQKGCGSFEDVRTVAGRLLPSFRSAWYVLGLLGEDKEWLLAFDDAAVWASAAQLCSLFYHLLLFCDVTDPLFFWSHAWNRMGDDILH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G480260`
TK1151 ID	TkA04G480260
OH-1004 ID	LXL04_015388
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	50.200
Protein coverage (%)	TK1151 90.041 / OH-1004 53.749 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G480260`
Location	Chr04:121320938-121326547 (-)
Description	Similar to pif1: ATP-dependent DNA helicase PIF1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015388` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000723 telomere maintenance Biological Process GO:0001117 protein-DNA-RNA complex disassembly Biological Process GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0042645 mitochondrial nucleoid Cellular Component GO:0000287 magnesium ion binding Molecular Function
KEGG gene cross-reference	hsa:80119 mmu:208084 rno:367645 xla:734585 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.879

Rank 1 · TkA04G480260 · TK1151

Cytoplasm0.200

Rank 2 · TkA04G480260 · TK1151

Mitochondrion0.034

Rank 3 · TkA04G480260 · TK1151

Cell membrane0.015

Rank 4 · TkA04G480260 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA04G480260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05970PIF1351-517 aa

PF21530Pif1_2B_dom592-638 aa

PF13538UvrD_C_2685-723 aa

PF02689Herpes_Helicase686-729 aa

PF16900REPA_OB_2847-928 aa

PF08646Rep_fac-A_C948-1035 aa

PF03310Cauli_DNA-bind984-1071 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G480260	`PF05970`	PIF1	351	517	5.5e-51	174.0
TkA04G480260	`PF21530`	Pif1_2B_dom	592	638	2.5e-15	56.6
TkA04G480260	`PF13538`	UvrD_C_2	685	723	0.0011	19.4
TkA04G480260	`PF02689`	Herpes_Helicase	686	729	1.7e-06	27.1
TkA04G480260	`PF16900`	REPA_OB_2	847	928	0.13	13.0
TkA04G480260	`PF08646`	Rep_fac-A_C	948	1035	0.24	11.9
TkA04G480260	`PF03310`	Cauli_DNA-bind	984	1071	0.29	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card