TkA04G462790 | RubberDandelionOmics

Gene overview

TkA04G462790

Reference: TK1151 Chr: Chr04 Coordinates: 116832255-116837752 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1592 bp · TkA04G462790|TK1151|cDNA

TGAAATCTGATAACAACAAAAGATTATCCGGGGACCACCAGCAGGTATTAACTTTCCTCGCCGTGTATATTAAAACCCGAAAAGGGATCCTCCCTCCGCACCATTCCCTTCACGGCGGCGTTGCATGTGCCCTCTCTCCTCCACCAAAAATCTCGTCGCCGACACAGACCCACCTCCGATACCTCCACAATGTCGACATTCATCCAACGATACCCCGTCATCGTCGCCGACGGTTTCTCTCGATCATCATTTCCGTCATC...

CDS

Download CDS FASTA

1179 bp · TkA04G462790|TK1151|CDS

ATGTCGACATTCATCCAACGATACCCCGTCATCGTCGCCGACGGTTTCTCTCGATCATCATTTCCGTCATCTACTAGACGTTCCCTCAAATTCAACGTGGCGTGTTGCTCCGCTCCATCGCCGCTGACGTATGTGAACGGAAATGTAGACAAGAAATCGACGGAGAGGAGTGAGATTAGGCTAGGATTGCCGAGCAAAGGCCGACTGGCTGCTGATACTCTTAACCTTCTGAATGATTGTCAGCTATCTGTGAGGCATCC...

Protein

Download Protein FASTA

392 aa · TkA04G462790|TK1151|PROTEIN

MSTFIQRYPVIVADGFSRSSFPSSTRRSLKFNVACCSAPSPLTYVNGNVDKKSTERSEIRLGLPSKGRLAADTLNLLNDCQLSVRHPNSRQYVADIPQLTNLEVWFQRPKDIVRKLVSGDLDIGIVGLDTVSEYGQGNEDLILVHDALAYGECRLSLAVPKNGIFKNINSVEELALMPQWTAEKPLRVATGFTYLGPKFLKENGVHHVTFSTADGALEAAPAMGIADAIVDLVSSGATLKENNMKEIEGGVLLKSQAVMV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G462790`
TK1151 ID	TkA04G462790
OH-1004 ID	LXL04_016936
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	79.600
Protein coverage (%)	TK1151 93.878 / OH-1004 92.462 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G462790

Location Chr04:116832255-116837752 (+)

Description Similar to HISN1B: ATP phosphoribosyltransferase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g58080`	Catalyzes the condensation of ATP and 5-phosphoribose 1-diphosphate to form N'-(5'-phosphoribosyl)-ATP (PR-ATP).	No verified direct reference in this release
`At1g09795`	Catalyzes the condensation of ATP and 5-phosphoribose 1-diphosphate to form N'-(5'-phosphoribosyl)-ATP (PR-ATP).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0134300`	Catalyzes the condensation of ATP and 5-phosphoribose 1-diphosphate to form N'-(5'-phosphoribosyl)-ATP (PR-ATP).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016936 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000105 L-histidine biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0003879 ATP phosphoribosyltransferase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G09795

ath:AT1G58080

bfr:BF3190

dosa:Os03g0134300

gau:GAU_0140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.961

Rank 1 · TkA04G462790 · TK1151

Mitochondrion0.050

Rank 2 · TkA04G462790 · TK1151

Cytoplasm0.037

Rank 3 · TkA04G462790 · TK1151

Nucleus0.036

Rank 4 · TkA04G462790 · TK1151

Peroxisome0.023

Rank 5 · TkA04G462790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01634HisG108-277 aa

PF02719Polysacc_synt_2201-289 aa

PF00557Peptidase_M24278-342 aa

PF08029HisG_C292-373 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G462790	`PF01634`	HisG	108	277	7.6e-38	130.6
TkA04G462790	`PF02719`	Polysacc_synt_2	201	289	0.019	14.9
TkA04G462790	`PF00557`	Peptidase_M24	278	342	0.19	12.2
TkA04G462790	`PF08029`	HisG_C	292	373	1.4e-10	41.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S762`	Arabidopsis thaliana	sp\|Q9S762\|HIS1A_ARATH ATP phosphoribosyltransferase 1, chloroplastic	63.300%	Swiss-Prot	High
`Q8GSJ1`	Arabidopsis thaliana	sp\|Q8GSJ1\|HIS1B_ARATH ATP phosphoribosyltransferase 2, chloroplastic	69.900%	Swiss-Prot	High
`Q10S55`	Oryza sativa subsp. japonica	sp\|Q10S55\|HIS1_ORYSJ ATP phosphoribosyltransferase, chloroplastic	62.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card