TkA04G376110 | RubberDandelionOmics

Gene overview

TkA04G376110

Reference: TK1151 Chr: Chr04 Coordinates: 94780771-94783930 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2427 bp · TkA04G376110|TK1151|cDNA

ATGCTTTACTGCGATAACCCGGCTACTAGTCAAATCGAAATTGATGTATGGCAATCAGCTATCGACATAGCAATAGGTCTAAATCCTACCTGGACAACCGATGCCAAACTCAATTACATGGAAAACACTTTAGGCGGCACCGCAAAGCTTGCCTGGTTTTCTTTCAAAAAGTCAACAAACTATCAAGAGTTTTTGACAAAATTTGGCCAAACCAAAGGCGCAGAATCCGGTAAACAAGAGTACCTTGATATGTATTTTGC...

CDS

Download CDS FASTA

2427 bp · TkA04G376110|TK1151|CDS

ATGCTTTACTGCGATAACCCGGCTACTAGTCAAATCGAAATTGATGTATGGCAATCAGCTATCGACATAGCAATAGGTCTAAATCCTACCTGGACAACCGATGCCAAACTCAATTACATGGAAAACACTTTAGGCGGCACCGCAAAGCTTGCCTGGTTTTCTTTCAAAAAGTCAACAAACTATCAAGAGTTTTTGACAAAATTTGGCCAAACCAAAGGCGCAGAATCCGGTAAACAAGAGTACCTTGATATGTATTTTGC...

Protein

Download Protein FASTA

808 aa · TkA04G376110|TK1151|PROTEIN

MLYCDNPATSQIEIDVWQSAIDIAIGLNPTWTTDAKLNYMENTLGGTAKLAWFSFKKSTNYQEFLTKFGQTKGAESGKQEYLDMYFAKLPQPFGDEAKKTYKTDKGDSIGTRMAHVKSCINNLCLANMLRKQSKLNSTICKQYLPISYKFGCAPSTSKITRKKKKKKKKTHHRVSTWKERFRRPKRKSHKPRFFKKREKHSYSKKPTTKKPKVSMKQILITVVHLNHLQNELQLYHKKKQLESQKSSKDFRRYVPKNAQR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G376110`
TK1151 ID	TkA04G376110
OH-1004 ID	LXL04_005007
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	42.600
Protein coverage (%)	TK1151 25.866 / OH-1004 29.462 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G376110`
Location	Chr04:94780771-94783930 (+)
Description	Similar to ORF V: Enzymatic polyprotein (Figwort mosaic virus (strain DxS)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005007` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function
KEGG gene cross-reference	vg:1489542 vg:935429 vg:940156 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.601

Rank 1 · TkA04G376110 · TK1151

Nucleus0.397

Rank 2 · TkA04G376110 · TK1151

Mitochondrion0.071

Rank 3 · TkA04G376110 · TK1151

Cell membrane0.051

Rank 4 · TkA04G376110 · TK1151

Endoplasmic reticulum0.038

Rank 5 · TkA04G376110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22909Caulimovir_coat_dom55-144 aa

PF02160Peptidase_A3340-506 aa

PF15861partial_CstF483-501 aa

PF00078RVT_1586-714 aa

PF15861partial_CstF749-793 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G376110	`PF22909`	Caulimovir_coat_dom	55	144	4.2e-09	37.4
TkA04G376110	`PF02160`	Peptidase_A3	340	506	0.00012	22.4
TkA04G376110	`PF15861`	partial_CstF	483	501	0.22	12.0
TkA04G376110	`PF00078`	RVT_1	586	714	5.1e-30	105.6
TkA04G376110	`PF15861`	partial_CstF	749	793	0.22	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card