TkA04G268650 | RubberDandelionOmics

Gene overview

TkA04G268650

Reference: TK1151 Chr: Chr04 Coordinates: 67890299-67892500 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1544 bp · TkA04G268650|TK1151|cDNA

GTGAAATTCATCCTTGAATCGGCTCTACATGCATAATCAACACTTGCTATAAAGCGTGCAATTTGCCTATCAGCCTGTCGTAAAGTCATCGGATTTCTCCGGCAAGGTGATATCAAGTTGCGACAATGGCATCCTCTGTATTTTCTACACATGGCACCACACGATTTCCTGAAGGAAGGAACATCTTTGGTGATTCAAATAAGTCAAATCTCTTCCATTACAAGAAAAACCATTCACCAGCTACCTTAACACACTCAAGT...

CDS

Download CDS FASTA

1140 bp · TkA04G268650|TK1151|CDS

ATGGCATCCTCTGTATTTTCTACACATGGCACCACACGATTTCCTGAAGGAAGGAACATCTTTGGTGATTCAAATAAGTCAAATCTCTTCCATTACAAGAAAAACCATTCACCAGCTACCTTAACACACTCAAGTCTGTTATCCAAAAACAGAATCCAATGTAGGGCAATAGAGGTCCAAACCAACCACACCTTCTTAAAGGGAGACAAATTTCAACTTGAAGATGTGATTGAGGCACAACAATTTGACAGAGATACCCT...

Protein

Download Protein FASTA

379 aa · TkA04G268650|TK1151|PROTEIN

MASSVFSTHGTTRFPEGRNIFGDSNKSNLFHYKKNHSPATLTHSSLLSKNRIQCRAIEVQTNHTFLKGDKFQLEDVIEAQQFDRDTLSAIFKVAREMETIEKNSHGSQLLNGYLMATLFYEPSTRTRLSFESAMKRLGGEVLTTENAREFSSAAKGETLEDSIRTVEGYSDIIVMRHFESGAARRAAMTANIPVINAGDGPGQHPTQALLDMYTIEREIGKLDGIKVGLVGDLANGRTVRSLAYLLAKYDNVKVYFVSPQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G268650`
TK1151 ID	TkA04G268650
OH-1004 ID	LXL04_037293
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G268650

Location Chr04:67890299-67892500 (+)

Description Similar to PYRB2: Aspartate carbamoyltransferase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20330`	Catalyzes the condensation of carbamoyl phosphate and aspartate to form carbamoyl aspartate and inorganic phosphate, the committed step in the de novo pyrimidine nucleotide biosynthesis pathway.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0248800`	Catalyzes the condensation of carbamoyl phosphate and aspartate to form carbamoyl aspartate and inorganic phosphate, the committed step in the de novo pyrimidine nucleotide biosynthesis pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037293 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006207 'de novo' pyrimidine nucleobase biosynthetic process Biological Process

GO:0006520 amino acid metabolic process Biological Process

GO:0006541 glutamine metabolic process Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0044205 'de novo' UMP biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004070 aspartate carbamoyltransferase activity Molecular Function

GO:0016597 amino acid binding Molecular Function

KEGG gene cross-reference

ath:AT3G20330

dosa:Os08g0248800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.970

Rank 1 · TkA04G268650 · TK1151

Mitochondrion0.054

Rank 2 · TkA04G268650 · TK1151

Cytoplasm0.018

Rank 3 · TkA04G268650 · TK1151

Nucleus0.014

Rank 4 · TkA04G268650 · TK1151

Peroxisome0.010

Rank 5 · TkA04G268650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02729OTCace_N75-216 aa

PF00185OTCace223-374 aa

PF21377MurD_N226-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G268650	`PF02729`	OTCace_N	75	216	3.4e-46	157.7
TkA04G268650	`PF00185`	OTCace	223	374	6.9e-33	114.6
TkA04G268650	`PF21377`	MurD_N	226	296	0.00084	20.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P49077`	Arabidopsis thaliana	sp\|P49077\|PYRB_ARATH Aspartate carbamoyltransferase, chloroplastic	79.900%	Swiss-Prot	High
`Q9LD61`	Oryza sativa subsp. japonica	sp\|Q9LD61\|PYRB_ORYSJ Aspartate carbamoyltransferase, chloroplastic	81.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card