TkA04G231590 | RubberDandelionOmics

Gene overview

TkA04G231590

Reference: TK1151 Chr: Chr04 Coordinates: 58807814-58811722 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1876 bp · TkA04G231590|TK1151|cDNA

CGATTACAAGGCTGTGATACTCCACTAGACGACAAGCTTGACATCAGAAACAACGACCACGTCACTCCGGCGACTCCCAATAAGCCGGGAGACGACAAAAGCGAGATCTTCCCCCAACCACTGTTCACCACCTCCACCACCACCGCCACCACCTTATCATTCGTCCTCGACGGTGGATTTATTCATAAACAGCTGTAAAGACCAGCTGAAAGAAACCAAACCATTTATGTATGCTGCCTACCTTCCCTTAACATCTCCGT...

CDS

Download CDS FASTA

1260 bp · TkA04G231590|TK1151|CDS

ATGGCTTTCTCGTCTCTTCTCCGATCAACCAACCCACCACCTGCTCTCGAAGCATCCCGTCAATCACTCACCGCCCCTTCATTTTCCACCCGATCACAGGTGTCGTCGGTGAAACTTCAATCCACCGTGTTTGTTTCTAGGGAATCGTCATCTTTACAGATACCTCATTCACGGTGCATCAATCCAATCAAAGCCACTGCCACTGAGTCGCCGCCAACTGTTCCAAAGTCCAGTACCGGCGGCAAGACCAAGGTCGGAAT...

Protein

Download Protein FASTA

419 aa · TkA04G231590|TK1151|PROTEIN

MAFSSLLRSTNPPPALEASRQSLTAPSFSTRSQVSSVKLQSTVFVSRESSSLQIPHSRCINPIKATATESPPTVPKSSTGGKTKVGINGFGRIGRLVLRIATFRDDIEIVAVNDPFIDSKYMAYMLKYDSTHGLFQGTIDVVDESTLEINGKQIKVTSQRDPATIPWGDFGADYVVESSGVFTTLDTASAHKKGGAKKVVISAISADAPMFVVGVNESTYKSNMDIVSNASCTTNCLAPLAKVVHEEFGIVEGLMTTVHA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G231590`
TK1151 ID	TkA04G231590
OH-1004 ID	LXL04_039925
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.800
Protein coverage (%)	TK1151 99.523 / OH-1004 48.715 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G231590

Location Chr04:58807814-58811722 (-)

Description Similar to GAPCP2: Glyceraldehyde-3-phosphate dehydrogenase GAPCP2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79530`	Involved in plastidial glycolytic pathway and plays a specific role in glycolytic energy production in non-green plastids and chloroplasts.	Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis.2009 · DOI: 10.1104/pp.109.143701 The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for viable pollen development in Arabidopsis.2010 · DOI: 10.1104/pp.109.150458
`At1g16300`	Involved in plastidial glycolytic pathway and plays a specific role in glycolytic energy production in non-green plastids and chloroplasts.	Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis.2009 · DOI: 10.1104/pp.109.143701 The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for viable pollen development in Arabidopsis.2010 · DOI: 10.1104/pp.109.150458

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039925 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006006 glucose metabolic process Biological Process

GO:0006096 glycolytic process Biological Process

GO:0009555 pollen development Biological Process

GO:0048658 anther wall tapetum development Biological Process

GO:0080022 primary root development Biological Process

GO:0080144 intracellular amino acid homeostasis Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004365 glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity Molecular Function

KEGG gene cross-reference

ath:AT1G16300

ath:AT1G79530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.981

Rank 1 · TkA04G231590 · TK1151

Mitochondrion0.036

Rank 2 · TkA04G231590 · TK1151

Cytoplasm0.022

Rank 3 · TkA04G231590 · TK1151

Peroxisome0.015

Rank 4 · TkA04G231590 · TK1151

Nucleus0.014

Rank 5 · TkA04G231590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF028262-Hacid_dh_C82-130 aa

PF00044Gp_dh_N84-184 aa

PF01113DapB_N84-115 aa

PF00044Gp_dh_N199-226 aa

PF01113DapB_N199-201 aa

PF02800Gp_dh_C231-396 aa

PF01113DapB_N322-344 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G231590	`PF02826`	2-Hacid_dh_C	82	130	0.022	14.8
TkA04G231590	`PF00044`	Gp_dh_N	84	184	4.7e-38	130.3
TkA04G231590	`PF01113`	DapB_N	84	115	0.085	13.7
TkA04G231590	`PF00044`	Gp_dh_N	199	226	4.7e-38	130.3
TkA04G231590	`PF01113`	DapB_N	199	201	0.085	13.7
TkA04G231590	`PF02800`	Gp_dh_C	231	396	4e-74	248.7
TkA04G231590	`PF01113`	DapB_N	322	344	0.085	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SAJ6`	Arabidopsis thaliana	sp\|Q9SAJ6\|G3PP1_ARATH Glyceraldehyde-3-phosphate dehydrogenase GAPCP1, chloroplastic	78.800%	Swiss-Prot	High
`Q5E924`	Arabidopsis thaliana	sp\|Q5E924\|G3PP2_ARATH Glyceraldehyde-3-phosphate dehydrogenase GAPCP2, chloroplastic	86.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card