LXL04_039925 | RubberDandelionOmics

Gene overview

LXL04_039925

Reference: OH-1004 Chr: JAJTUU010000090.1 Coordinates: 77966-88268 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2571 bp · LXL04_039925|LXL04_039925|OH1004|cDNA

ATGGCTTTCTCGTCTCTTCTCCGATCAACCAACCCACCACCTGCTCTCGAAGCATCCCGTCAATCACTCACCGCCCCTTCATTTTCCACCCGATCACAGGTGTCGTCGGTGAAACTTCAATCCACCGTGTTTGTTTCTAGGGAATCGTCATCTTTACAGATACCTCATTCACGGTGCATCAATCCAATCAAAGCCACTGCCACTGAGTCGCCGCCAACTGTTCCAAAGTCCAGTACCGGCGGCAAGACCAAGGTCGGAAT...

CDS

Download CDS FASTA

2571 bp · LXL04_039925|LXL04_039925|OH1004|CDS

ATGGCTTTCTCGTCTCTTCTCCGATCAACCAACCCACCACCTGCTCTCGAAGCATCCCGTCAATCACTCACCGCCCCTTCATTTTCCACCCGATCACAGGTGTCGTCGGTGAAACTTCAATCCACCGTGTTTGTTTCTAGGGAATCGTCATCTTTACAGATACCTCATTCACGGTGCATCAATCCAATCAAAGCCACTGCCACTGAGTCGCCGCCAACTGTTCCAAAGTCCAGTACCGGCGGCAAGACCAAGGTCGGAAT...

Protein

Download Protein FASTA

856 aa · LXL04_039925|LXL04_039925|OH1004|PROTEIN

MAFSSLLRSTNPPPALEASRQSLTAPSFSTRSQVSSVKLQSTVFVSRESSSLQIPHSRCINPIKATATESPPTVPKSSTGGKTKVGINGFGRIGRLVLRIATFRDDIEIVAVNDPFIDAKYMAYMLKYDSTHGLFQGTIDVVDESTLEINGKQIKVTSQRDPATIPWGDFGADYVVESSGVFTTLDTASAHKKGGAKKVVISAPSADAPMFVVGVNESTYKSNMDIVSNASCTTNCLAPLAKVVHEEFGIVEGLMTTVHA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039925`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039925

Location JAJTUU010000090.1:77966-88268 (+)

Description Similar to GAPCP2: Glyceraldehyde-3-phosphate dehydrogenase GAPCP2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16300`	Involved in plastidial glycolytic pathway and plays a specific role in glycolytic energy production in non-green plastids and chloroplasts.	Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis.2009 · DOI: 10.1104/pp.109.143701 The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for viable pollen development in Arabidopsis.2010 · DOI: 10.1104/pp.109.150458
`At1g79530`	Involved in plastidial glycolytic pathway and plays a specific role in glycolytic energy production in non-green plastids and chloroplasts.	Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency leads to altered root development and affects the sugar and amino acid balance in Arabidopsis.2009 · DOI: 10.1104/pp.109.143701 The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for viable pollen development in Arabidopsis.2010 · DOI: 10.1104/pp.109.150458
`At1g13440`	Key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	Cytosolic glyceraldehyde-3-phosphate dehydrogenases interact with phospholipase Dδ to transduce hydrogen peroxide signals in the Arabidopsis response to stress.2012 · DOI: 10.1105/tpc.111.094946

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039925 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006006 glucose metabolic process Biological Process

GO:0006096 glycolytic process Biological Process

GO:0009555 pollen development Biological Process

GO:0048658 anther wall tapetum development Biological Process

GO:0080022 primary root development Biological Process

GO:0080144 intracellular amino acid homeostasis Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004365 glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity Molecular Function

KEGG gene cross-reference

ath:AT1G16300

ath:AT1G79530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.617

Rank 1 · LXL04_039925 · OH-1004

Nucleus0.163

Rank 2 · LXL04_039925 · OH-1004

Plastid0.132

Rank 3 · LXL04_039925 · OH-1004

Mitochondrion0.092

Rank 4 · LXL04_039925 · OH-1004

Peroxisome0.087

Rank 5 · LXL04_039925 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00044.31Gp_dh_N84-184 aa

PF02800.27Gp_dh_C231-396 aa

PF00044.31Gp_dh_N495-595 aa

PF02800.27Gp_dh_C642-807 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039925	`PF00044.31`	Gp_dh_N	84	184	1.4e-75	250.8
LXL04_039925	`PF02800.27`	Gp_dh_C	231	396	1.1e-149	494.4
LXL04_039925	`PF00044.31`	Gp_dh_N	495	595	1.4e-75	250.8
LXL04_039925	`PF02800.27`	Gp_dh_C	642	807	1.1e-149	494.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5E924`	Arabidopsis thaliana	Glyceraldehyde-3-phosphate dehydrogenase GAPCP2, chloroplastic	78.436%	Swiss-Prot	weak database homology
`Q9SAJ6`	Arabidopsis thaliana	Glyceraldehyde-3-phosphate dehydrogenase GAPCP1, chloroplastic	78.810%	Swiss-Prot	weak database homology
`Q9FX54`	Arabidopsis thaliana	Glyceraldehyde-3-phosphate dehydrogenase GAPC2, cytosolic	72.619%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card