TkA04G230650 | RubberDandelionOmics

Gene overview

TkA04G230650

Reference: TK1151 Chr: Chr04 Coordinates: 58582161-58588598 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2148 bp · TkA04G230650|TK1151|cDNA

TGTGTGAAACTCGTGAAACTGATAGTTTAAAATTTAAATAACCATCTCTATCAGCTCCAAACTAATCAGATTACACCGAAGATAGATCAGTTATAATAACCCACTAGATCCGAACTTCAACATCCTTATCAATTCGTGACGAAATCAAATTGGGGGAATTATTTTTCTCTTGTTATATCAATCATCATCGAAGTGTTGTTGGGAGAATCAACAACCGGTGTGCTGGAAGCTTAATCTTTCGCCATTTGTACAAGAGTGCC...

CDS

Download CDS FASTA

1608 bp · TkA04G230650|TK1151|CDS

ATGATAACGACGATGTTTGCTCGCACAATTCATCGCAGATTCAGTTTTCACCACTCTTCAATCTCACTCTCGAACTCATTACGTGGCAACAACAGCCACTCCCCCACGAATCTTCTTCGTCGCGAGATGAGCATGGAAACAGAACGTATTGTTGATCGGCTCAAGAGTTCTGGGCTATTGCAAACGAAAGGGCTTATTGGAGGGAAGTGGACTGATGCTTATGATGGGAAGACCATTGAGGTTAACAATCCTGCTAGTGG...

Protein

Download Protein FASTA

535 aa · TkA04G230650|TK1151|PROTEIN

MITTMFARTIHRRFSFHHSSISLSNSLRGNNSHSPTNLLRREMSMETERIVDRLKSSGLLQTKGLIGGKWTDAYDGKTIEVNNPASGDVIASVACMGERETKDAISSAYDAFSHWSKLTANDRSSRLRNWYNLLLQHKEELGQLITLEQGKPLKEAIGEVGYGASFIEFFAEEAKRIYGDIIPSTLSDRRLFVLKQPVGVVAAITPWNFPLAMIARKVGPALACGCTVVIKPSELTPLTALAAAELALQSGIPPGVLNVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G230650`
TK1151 ID	TkA04G230650
OH-1004 ID	LXL04_039355
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G230650

Location Chr04:58582161-58588598 (-)

Description Similar to ALDH5F1: Succinate-semialdehyde dehydrogenase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79440`	Oxidizes specifically succinate semialdehyde.	Plant succinic semialdehyde dehydrogenase. Cloning, purification, localization in mitochondria, and regulation by adenine nucleotides.1999 · DOI: 10.1104/pp.121.2.589 Succinic semialdehyde dehydrogenase is involved in the robust patterning of Arabidopsis leaves along the adaxial-abaxial axis.2011 · DOI: 10.1093/pcp/pcr079

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0173900`	Oxidizes specifically succinate semialdehyde.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039355 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006540 gamma-aminobutyrate shunt Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009450 gamma-aminobutyric acid catabolic process Biological Process

GO:0009943 adaxial/abaxial axis specification Biological Process

GO:0010492 maintenance of shoot apical meristem identity Biological Process

GO:0019477 L-lysine catabolic process Biological Process

GO:0048366 leaf development Biological Process

GO:0048825 cotyledon development Biological Process

GO:0051289 protein homotetramerization Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

KEGG gene cross-reference

aci:ACIAD2539

ath:AT1G79440

dosa:Os02g0173900

ecj:JW2636

eco:b2661

pae:PA0265

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.669

Rank 1 · TkA04G230650 · TK1151

Plastid0.149

Rank 2 · TkA04G230650 · TK1151

Cytoplasm0.111

Rank 3 · TkA04G230650 · TK1151

Peroxisome0.102

Rank 4 · TkA04G230650 · TK1151

Nucleus0.039

Rank 5 · TkA04G230650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00171Aldedh70-529 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G230650	`PF00171`	Aldedh	70	529	2.9e-174	580.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SAK4`	Arabidopsis thaliana	sp\|Q9SAK4\|SSDH_ARATH Succinate-semialdehyde dehydrogenase, mitochondrial	77.500%	Swiss-Prot	High
`B9F3B6`	Oryza sativa subsp. japonica	sp\|B9F3B6\|SSDH_ORYSJ Succinate-semialdehyde dehydrogenase, mitochondrial	77.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card