Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1608 bp · LXL04_039355|LXL04_039355|OH1004|cDNA
ATGATAACGACGATGTTTGCTCGCACAATTCATCGCAGATTCAGTTTTCATCACTCTTCAATCTCACTCTCGAACTCATTACGTGGCAACAACAGCCACTCCCCCACGAATCTTCTTCGTCGCGAGATGAGCATGGAAACAGAACGTATTGTTGATCGGCTCAAGAGTTCTGGGCTATTGCAAACGAAAGGGCTTATTGGAGGGAAGTGGACTGATGCTTATGATGGGAAGACCATTGAGGTTAACAATCCTGCTAGTGG...
1608 bp · LXL04_039355|LXL04_039355|OH1004|CDS
ATGATAACGACGATGTTTGCTCGCACAATTCATCGCAGATTCAGTTTTCATCACTCTTCAATCTCACTCTCGAACTCATTACGTGGCAACAACAGCCACTCCCCCACGAATCTTCTTCGTCGCGAGATGAGCATGGAAACAGAACGTATTGTTGATCGGCTCAAGAGTTCTGGGCTATTGCAAACGAAAGGGCTTATTGGAGGGAAGTGGACTGATGCTTATGATGGGAAGACCATTGAGGTTAACAATCCTGCTAGTGG...
Protein
Download Protein FASTA535 aa · LXL04_039355|LXL04_039355|OH1004|PROTEIN
MITTMFARTIHRRFSFHHSSISLSNSLRGNNSHSPTNLLRREMSMETERIVDRLKSSGLLQTKGLIGGKWTDAYDGKTIEVNNPASGDVIASVACMGERETKDAISSAYDAFSHWSKLTANDRSSRLRNWYNLLLQHKEELGQLITLEQGKPLKEAIGEVGYGASFIEFFAEEAKRIYGDIIPSTLSDRRLFVLKQPVGVVAAITPWNFPLAMIARKVGPALACGCTVVIKPSELTPLTALAAAELALQSGIPPGVLNVV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_039355 |
|---|---|
| TK1151 ID | TkA04G230650 |
| OH-1004 ID | LXL04_039355 |
| Relationship / confidence | Multi Candidate From Tk1151 / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_039355 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | JAJTUU010000010.1:3907109-3912881 (+) | ||||||||||||
| Description | Similar to ALDH5F1: Succinate-semialdehyde dehydrogenase, mitochondrial | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006540 gamma-aminobutyrate shunt Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0009416 response to light stimulus Biological Process GO:0009450 gamma-aminobutyric acid catabolic process Biological Process GO:0009943 adaxial/abaxial axis specification Biological Process GO:0010492 maintenance of shoot apical meristem identity Biological Process GO:0019477 L-lysine catabolic process Biological Process GO:0048366 leaf development Biological Process GO:0048825 cotyledon development Biological Process GO:0051289 protein homotetramerization Biological Process GO:0072593 reactive oxygen species metabolic process Biological Process | ||||||||||||
| KEGG gene cross-reference | aci:ACIAD2539 ath:AT1G79440 dosa:Os02g0173900 ecj:JW2636 eco:b2661 pae:PA0265 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00171.28Aldedh70-529 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_039355 | PF00171.28 | Aldedh | 70 | 529 | 2.9e-174 | 580.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.