TkA04G175660 | RubberDandelionOmics

Gene overview

TkA04G175660

Reference: TK1151 Chr: Chr04 Coordinates: 45481002-45483640 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2071 bp · TkA04G175660|TK1151|cDNA

GGGATATGTGTGGTAAACATGAGCCCATATAATGCATAAAGTTGTTAAATGCTAACCCCAAAACCCCATCTCCCAATCTTAAAACCTTCAAACGAACAATCAGTTTCTGACAGCCACGTGGCAGAGCGCGCAATCTTGTTTTTGTGGACTTCAATGACTCAAAAACTAATCCACCCCCATCTTAACTTCATCACTATAAGTCATCATCTCTTACTACCTTCAGATCATTCTGCAGTCCGTCTTCACTCCTGCTTTCTATC...

CDS

Download CDS FASTA

1437 bp · TkA04G175660|TK1151|CDS

ATGGCAGCCGCCGTCTCCACCATTGGAGCCGTCAACCGTATTCCGTTGAACTTGAATGGAAGCAGCGGAAGTGTTGCAGTCCCAAACTCCAGTTTCTTGGGAAGCAGCTTGAAGAAGATAGTGAACTCGAGATTTATCAACAACAGCAACAAGTCTTTCTCCTTCAAAATATTCGCAGCTGAGAAGGAAATCGAGGAAACCCAACAGACTGACAAAGACAGATGGAAGGGACTCGCATATGATATGTCTGATGATCAACA...

Protein

Download Protein FASTA

478 aa · TkA04G175660|TK1151|PROTEIN

MAAAVSTIGAVNRIPLNLNGSSGSVAVPNSSFLGSSLKKIVNSRFINNSNKSFSFKIFAAEKEIEETQQTDKDRWKGLAYDMSDDQQDITRGKGMVDSLFQAPQDVGTHFAVMSSYEYISTGLRSYNLDNSMDGFYIAPAFMDKLVVHITKNFMTLPNIKVPLILGVWGGKGQGKSFQCELVFAKMGITPIMMSAGELESGNAGEPAKLIRQRYREAADIIKKGKMCCLFINDLDAGAGRMGGTTQYTVNNQMVNATLMN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G175660`
TK1151 ID	TkA04G175660
OH-1004 ID	LXL04_035043
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 92.469 / OH-1004 85.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G175660

Location Chr04:45481002-45483640 (+)

Description Similar to RCA: Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39730`	Activation of RuBisCO (ribulose-1,5-bisphosphate carboxylase/oxygenase; EC 4.1.1.39) involves the ATP-dependent carboxylation of the epsilon-amino group of lysine leading to a carbamate structure.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0707000`	Activation of RuBisCO (ribulose-1,5-bisphosphate carboxylase/oxygenase; EC 4.1.1.39) involves the ATP-dependent carboxylation of the epsilon-amino group of lysine leading to a carbamate structure.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035043 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0046863 ribulose-1,5-bisphosphate carboxylase/oxygenase activator activity Molecular Function

KEGG gene cross-reference

mdm:103456062

vra:106757684

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.919

Rank 1 · TkA04G175660 · TK1151

Nucleus0.043

Rank 2 · TkA04G175660 · TK1151

Cytoplasm0.040

Rank 3 · TkA04G175660 · TK1151

Mitochondrion0.037

Rank 4 · TkA04G175660 · TK1151

Endoplasmic reticulum0.029

Rank 5 · TkA04G175660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06309Torsin127-185 aa

PF00004AAA167-310 aa

PF00154RecA_N188-248 aa

PF10722YbjN303-352 aa

PF21228RuBisCO_activase_AAA_helical313-408 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G175660	`PF06309`	Torsin	127	185	0.0013	19.6
TkA04G175660	`PF00004`	AAA	167	310	4.7e-17	63.4
TkA04G175660	`PF00154`	RecA_N	188	248	0.15	12.2
TkA04G175660	`PF10722`	YbjN	303	352	0.24	12.3
TkA04G175660	`PF21228`	RuBisCO_activase_AAA_helical	313	408	2.9e-38	130.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P10896`	Arabidopsis thaliana	sp\|P10896\|RCA_ARATH Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic	79.400%	Swiss-Prot	High
`P93431`	Oryza sativa subsp. japonica	sp\|P93431\|RCA_ORYSJ Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic	76.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card