TkA04G157400 | RubberDandelionOmics

Gene overview

TkA04G157400

Reference: TK1151 Chr: Chr04 Coordinates: 40751589-40753829 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1399 bp · TkA04G157400|TK1151|cDNA

CTTATATAGCTGAATGATATGTAACTTCTTTCAGAGTTCAGGGGTGGATTTGCAATATCTTTTCTCAATTCCATTTACACCACGGCGAACAATCAGGTCGGTCCTTCAACGAGGATCAGCAGCAGTTACGTGATTCCCAACGGTCAGAGGCAGATCTAAGGAACGATCTAGGGTTTGTAAATCGGAAAACCTCATCGATATGATTCTGTCTCAGGAGATAATCACATTCTCGGGTCAAAGCTAAAATTTCCATCCCACTG...

CDS

Download CDS FASTA

732 bp · TkA04G157400|TK1151|CDS

ATGTCATCTTCTGCTCAAGACCCATTTTACATTGTGAAGGAAGAAATCCAGGATTCTATCCACGCATTACAAGGCACTTTTCACCAATGGGAACACACCCCTGTAGCCAGCGGGGCACAAAATCGTCTCACAAAAGAAGTCCTTTCCAATTGTGAAAGCATTGAATGGCAGGTGGATGAATTGGAGAAAGCTATTTCTGTAGCAGCTAGAGACCCTGCTTTATATGGAATCCCTAAATCCGAGCTTGAAAGAAGATTTCA...

Protein

Download Protein FASTA

243 aa · TkA04G157400|TK1151|PROTEIN

MSSSAQDPFYIVKEEIQDSIHALQGTFHQWEHTPVASGAQNRLTKEVLSNCESIEWQVDELEKAISVAARDPALYGIPKSELERRFQWTKSARTQVVNVKKAVTGTTSSTYGDMRQELMSLPSTRQQDILPTNYVTKENEDFISSESDRQLLLIRQQDEELDELSQSVQRIGNVGLTIHDELQAQEKLLEELGSEMDSTSNRLDFVQKKVAVVMKKASAKGQMMMILFLIVLFIILFVLVFFT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G157400`
TK1151 ID	TkA04G157400
OH-1004 ID	LXL04_035185
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G157400

Location Chr04:40751589-40753829 (-)

Description Similar to SYP61: Syntaxin-61

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g28490`	Vesicle trafficking protein that functions in the secretory pathway.	OSM1/SYP61: a syntaxin protein in Arabidopsis controls abscisic acid-mediated and non-abscisic acid-mediated responses to abiotic stress.2002 · DOI: 10.1105/tpc.006981 YKT6 is a core constituent of membrane fusion machineries at the Arabidopsis trans-Golgi network.2005 · DOI: 10.1016/j.jmb.2005.04.061 Isolation and proteomic analysis of the SYP61 compartment reveal its role in exocytic trafficking in Arabidopsis.2012 · DOI: 10.1038/cr.2011.129 Arabidopsis SNAREs SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability.2014 · DOI: 10.1105/tpc.114.127159 CESA TRAFFICKING INHIBITOR inhibits cellulose deposition and interferes with the trafficking of cellulose synthase complexes and their associated proteins KORRIGAN1 and POM2/CELLULOSE SYNTHASE INTERACTIVE PROTEIN1.2015 · DOI: 10.1104/pp.114.249003

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035185 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006887 exocytosis Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0007032 endosome organization Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0016189 synaptic vesicle to endosome fusion Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0032880 regulation of protein localization Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0048193 Golgi vesicle transport Biological Process

GO:0048278 vesicle docking Biological Process

KEGG gene cross-reference

ath:AT1G28490

gga:424413

mmu:58244

pon:100173487

rno:60562

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.443

Rank 1 · TkA04G157400 · TK1151

Lysosome / Vacuole0.281

Rank 2 · TkA04G157400 · TK1151

Cytoplasm0.228

Rank 3 · TkA04G157400 · TK1151

Endoplasmic reticulum0.146

Rank 4 · TkA04G157400 · TK1151

Cell membrane0.099

Rank 5 · TkA04G157400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09177STX6_10_61_N7-100 aa

PF05739SNARE14-29 aa

PF06825HSBP142-66 aa

PF04678MCU44-63 aa

PF05531NPV_P1048-65 aa

PF01519DUF1651-59 aa

PF05739SNARE57-62 aa

PF05531NPV_P1094-104 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G157400	`PF09177`	STX6_10_61_N	7	100	3.7e-23	82.6
TkA04G157400	`PF05739`	SNARE	14	29	7.2e-14	52.1
TkA04G157400	`PF06825`	HSBP1	42	66	0.055	14.0
TkA04G157400	`PF04678`	MCU	44	63	0.0067	17.3
TkA04G157400	`PF05531`	NPV_P10	48	65	2.7	9.3
TkA04G157400	`PF01519`	DUF16	51	59	0.25	12.5
TkA04G157400	`PF05739`	SNARE	57	62	7.2e-14	52.1
TkA04G157400	`PF05531`	NPV_P10	94	104	2.7	9.3
TkA04G157400	`PF09753`	Use1	96	238	0.031	14.7
TkA04G157400	`PF01519`	DUF16	131	205	0.25	12.5
TkA04G157400	`PF04678`	MCU	140	243	0.0067	17.3
TkA04G157400	`PF00482`	T2SSF	153	241	0.82	10.4
TkA04G157400	`PF05739`	SNARE	154	230	7.2e-14	52.1
TkA04G157400	`PF05531`	NPV_P10	154	199	2.7	9.3
TkA04G157400	`PF09177`	STX6_10_61_N	155	196	3.7e-23	82.6
TkA04G157400	`PF30871`	Sft1-BET1	156	214	0.16	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q946Y7`	Arabidopsis thaliana	sp\|Q946Y7\|SYP61_ARATH Syntaxin-61	61.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card