LXL04_035185 | RubberDandelionOmics

Gene overview

LXL04_035185

Reference: OH-1004 Chr: Chr08 Coordinates: 16896863-16897973 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

732 bp · LXL04_035185|LXL04_035185|OH1004|cDNA

ATGTCATCTTCTGCTCAAGACCCATTTTACATTGTGAAggaagaaatccaggattctATCCACGCATTACAAGGCACTTTTCACCAATGGGAACACACCCCTGTAGCCAGCGGGGCACAAAATCGTCTCACAAAAGAAGTCCTTTCCAATTGTGAAAGCATTGAATGGCAGGTGGATGAATTGGAGAAAGCTATTTCTGTAGCAGCTAGAGACCCTGCTTTATATGGAATCCCTAAATCCGAGCTTGAAAGAAGATTTCA...

CDS

Download CDS FASTA

732 bp · LXL04_035185|LXL04_035185|OH1004|CDS

ATGTCATCTTCTGCTCAAGACCCATTTTACATTGTGAAGGAAGAAATCCAGGATTCTATCCACGCATTACAAGGCACTTTTCACCAATGGGAACACACCCCTGTAGCCAGCGGGGCACAAAATCGTCTCACAAAAGAAGTCCTTTCCAATTGTGAAAGCATTGAATGGCAGGTGGATGAATTGGAGAAAGCTATTTCTGTAGCAGCTAGAGACCCTGCTTTATATGGAATCCCTAAATCCGAGCTTGAAAGAAGATTTCA...

Protein

Download Protein FASTA

243 aa · LXL04_035185|LXL04_035185|OH1004|PROTEIN

MSSSAQDPFYIVKEEIQDSIHALQGTFHQWEHTPVASGAQNRLTKEVLSNCESIEWQVDELEKAISVAARDPALYGIPKSELERRFQWTKSARTQVVNVKKAVTGTTSSTYGDMRQELMSLPSTRQQDILPTNYVTKENEDFISSESDRQLLLIRQQDEELDELSQSVQRIGNVGLTIHDELQAQEKLLEELGSEMDSTSNRLDFVQKKVAVVMKKASAKGQMMMILFLIVLFIVLFVLVFFT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035185`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035185

Location Chr08:16896863-16897973 (+)

Description Similar to SYP61: Syntaxin-61

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g28490`	Vesicle trafficking protein that functions in the secretory pathway.	OSM1/SYP61: a syntaxin protein in Arabidopsis controls abscisic acid-mediated and non-abscisic acid-mediated responses to abiotic stress.2002 · DOI: 10.1105/tpc.006981 YKT6 is a core constituent of membrane fusion machineries at the Arabidopsis trans-Golgi network.2005 · DOI: 10.1016/j.jmb.2005.04.061 Isolation and proteomic analysis of the SYP61 compartment reveal its role in exocytic trafficking in Arabidopsis.2012 · DOI: 10.1038/cr.2011.129 Arabidopsis SNAREs SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability.2014 · DOI: 10.1105/tpc.114.127159 CESA TRAFFICKING INHIBITOR inhibits cellulose deposition and interferes with the trafficking of cellulose synthase complexes and their associated proteins KORRIGAN1 and POM2/CELLULOSE SYNTHASE INTERACTIVE PROTEIN1.2015 · DOI: 10.1104/pp.114.249003

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035185 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006887 exocytosis Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0007032 endosome organization Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0016189 synaptic vesicle to endosome fusion Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0032880 regulation of protein localization Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0048193 Golgi vesicle transport Biological Process

GO:0048278 vesicle docking Biological Process

KEGG gene cross-reference

ath:AT1G28490

gga:424413

mmu:58244

pon:100173487

rno:60562

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.451

Rank 1 · LXL04_035185 · OH-1004

Lysosome / Vacuole0.275

Rank 2 · LXL04_035185 · OH-1004

Cytoplasm0.226

Rank 3 · LXL04_035185 · OH-1004

Endoplasmic reticulum0.147

Rank 4 · LXL04_035185 · OH-1004

Cell membrane0.097

Rank 5 · LXL04_035185 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09177.16STX6_10_61_N7-100 aa

PF05739.27SNARE154-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035185	`PF09177.16`	STX6_10_61_N	7	100	3.7e-23	82.6
LXL04_035185	`PF05739.27`	SNARE	154	230	7.2e-14	52.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q946Y7`	Arabidopsis thaliana	Syntaxin-61	63.673%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card