TkA04G141780 | RubberDandelionOmics

Gene overview

TkA04G141780

Reference: TK1151 Chr: Chr04 Coordinates: 36651220-36655615 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2782 bp · TkA04G141780|TK1151|cDNA

CGTGGTGAAAAATGAAAATTGGAGGGTAGTACCGCAACAAATTCCAAACCTAAGCGATCATGCTGCAAATATCACCAACTATCGTGAGTTCATAGTTCACCGACTGAAACATTTCGAGTGACCGGAGAAGATGATGATAGATTTGGGATCGTTCTCCGACGAGAAATTCGACGCCAAGAAATGGATAAACAATGCTTGCCAATCGCGGCACCCTCAGGATCCCTTAGACAAGCACCTAGTGGATCTCGAGATGAAGCTAC...

CDS

Download CDS FASTA

2451 bp · TkA04G141780|TK1151|CDS

ATGATGATAGATTTGGGATCGTTCTCCGACGAGAAATTCGACGCCAAGAAATGGATAAACAATGCTTGCCAATCGCGGCACCCTCAGGATCCCTTAGACAAGCACCTAGTGGATCTCGAGATGAAGCTACAGATGGTGTCCGAGGAGATAGCCGCCTCACTCGAGGAACAGAGCTCCGCCGCCATCCTCCGTGTCCCTCGCGCTACTCGTGACGTGATCCGCCTCCGTGACGATGCTCTCTCCCTCCGACAATCCGTCGC...

Protein

Download Protein FASTA

816 aa · TkA04G141780|TK1151|PROTEIN

MMIDLGSFSDEKFDAKKWINNACQSRHPQDPLDKHLVDLEMKLQMVSEEIAASLEEQSSAAILRVPRATRDVIRLRDDALSLRQSVASILLKLKKAEGSSAESIATLAKVDTVKQRMEAAYKTLQDAAGLTQLSSTVEDVFASNDLPRAAETLANMRHCLTAVGEVAEFANIRKQLEVLEDRLDSMVQPRLTDAITNRKVNVAQDLREILIRIGRYKSLESHYTKVHLKPIRQLWEDYELKQQRSKTGIERSQVETISSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G141780`
TK1151 ID	TkA04G141780
OH-1004 ID	LXL04_035337
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G141780

Location Chr04:36651220-36655615 (-)

Description Similar to COG7: Conserved oligomeric Golgi complex subunit 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51430`	Required for normal Golgi function.	EMBRYO YELLOW gene, encoding a subunit of the conserved oligomeric Golgi complex, is required for appropriate cell expansion and meristem organization in Arabidopsis thaliana.2008 · DOI: 10.1111/j.1365-2443.2008.01186.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035337 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000301 retrograde transport, vesicle recycling within Golgi Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0007030 Golgi organization Biological Process

GO:0009101 glycoprotein biosynthetic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010016 shoot system morphogenesis Biological Process

GO:0033365 protein localization to organelle Biological Process

GO:0034067 protein localization to Golgi apparatus Biological Process

GO:0045053 protein retention in Golgi apparatus Biological Process

KEGG gene cross-reference

ath:AT5G51430

bta:504790

hsa:91949

mmu:233824

rno:293456

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.512

Rank 1 · TkA04G141780 · TK1151

Golgi apparatus0.503

Rank 2 · TkA04G141780 · TK1151

Nucleus0.134

Rank 3 · TkA04G141780 · TK1151

Lysosome / Vacuole0.128

Rank 4 · TkA04G141780 · TK1151

Cell membrane0.111

Rank 5 · TkA04G141780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10191COG74-812 aa

PF10475Vps54_N8-187 aa

PF20651EXOC6_Sec15_N43-175 aa

PF11254DUF305344-160 aa

PF04513Baculo_PEP_C85-176 aa

PF30512DNA_pol3_delp_C94-192 aa

PF07393Sec10_HB357-421 aa

PF04513Baculo_PEP_C434-499 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G141780	`PF10191`	COG7	4	812	8.1e-260	865.1
TkA04G141780	`PF10475`	Vps54_N	8	187	0.01	15.9
TkA04G141780	`PF20651`	EXOC6_Sec15_N	43	175	0.0032	18.1
TkA04G141780	`PF11254`	DUF3053	44	160	0.35	11.2
TkA04G141780	`PF04513`	Baculo_PEP_C	85	176	1.3	9.7
TkA04G141780	`PF30512`	DNA_pol3_delp_C	94	192	0.061	14.0
TkA04G141780	`PF07393`	Sec10_HB	357	421	0.016	14.5
TkA04G141780	`PF04513`	Baculo_PEP_C	434	499	1.3	9.7
TkA04G141780	`PF07393`	Sec10_HB	450	489	0.016	14.5
TkA04G141780	`PF04513`	Baculo_PEP_C	548	562	1.3	9.7
TkA04G141780	`PF04513`	Baculo_PEP_C	631	660	1.3	9.7
TkA04G141780	`PF30512`	DNA_pol3_delp_C	709	757	0.061	14.0
TkA04G141780	`PF04513`	Baculo_PEP_C	750	808	1.3	9.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGN0`	Arabidopsis thaliana	sp\|Q9FGN0\|COG7_ARATH Conserved oligomeric Golgi complex subunit 7	73.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card