RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G137400
Reference: TK1151 Chr: Chr04 Coordinates: 35688856-35690974 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1651 bp · TkA04G137400|TK1151|cDNA

AAAATCCCCAAATCCTAATGATAAACCTTTTCAAAAAATTCCGTACGAATCTGTCATTGTAAACAGTCCGGTGTTACCTTCCCACATCGTAATTAACCAATCGAGCGATCGTCGGCCGTTTGCTCTTCTCGGGCGCGGAATTCCTCCATTTTCCACTCTGCTCAATCGGTTCTTGGGTTTACACAGTTGTGCTACACAGTCTAATCTAGGGTTTTTCTTACCCACCTCAAAACACCAATCATTTTTCCAATTTATAGAAG...

CDS

Download CDS FASTA

1062 bp · TkA04G137400|TK1151|CDS

ATGTCTGACTGGCAACAGTATGCTCAAACAATAATATTCGGTTTGATATTTTCATTTCTTCTTGCAAAGCTCTTTTCTATAATATTCTCGTTTCGCGACCAAAATCTCCGTATTACTCGTGCTAACTCTGACGAAGATCAATCTTACGAAAAAGTAAGTGAATCTGAATCCGAATCACCACACAAAGAGAAGAAACCAAGCGCGGAGTTTCCAAAGGATTACAATACTAGCGATGAAGACAAACCATTAGTTGTTCAAGG...

Protein

Download Protein FASTA

353 aa · TkA04G137400|TK1151|PROTEIN

MSDWQQYAQTIIFGLIFSFLLAKLFSIIFSFRDQNLRITRANSDEDQSYEKVSESESESPHKEKKPSAEFPKDYNTSDEDKPLVVQGHGNAWSSSDSDDDWEGVESTELDEAFSAATAFVAATAADRSSPKVSNDLQLQLYGLYKIATEGPCSVPQPSALKMTARAKWNAWQKLGAMPTDEAMLKYLEIITELYPTWVAGSTSKTRDGNANERSSNDTRPMGPVFSSLIHEEESNELKLDAIHAFAREGDTDNLLKCVEG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G137400
TK1151 IDTkA04G137400
OH-1004 IDLXL04_035369
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 89.822
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G137400
LocationChr04:35688856-35690974 (+)
DescriptionSimilar to ACBP1: Acyl-CoA-binding domain-containing protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g53470 Binds medium- and long-chain acyl-CoA esters with very high affinity.
Arabidopsis ACBP3 is an extracellularly targeted acyl-CoA-binding protein.2006 · DOI: 10.1007/s00425-005-0139-2
Overexpression of membrane-associated acyl-CoA-binding protein ACBP1 enhances lead tolerance in Arabidopsis.2008 · DOI: 10.1111/j.1365-313x.2008.03402.x
Acyl-CoA-Binding Protein ACBP1 Modulates Sterol Synthesis during Embryogenesis.2017 · DOI: 10.1104/pp.17.00412
Arabidopsis ACYL-COA-BINDING PROTEIN1 interacts with STEROL C4-METHYL OXIDASE1-2 to modulate gene expression of homeodomain-leucine zipper IV transcription factors.2018 · DOI: 10.1111/nph.14965
At4g27780 Binds medium- and long-chain acyl-CoA esters with very high affinity.
Single amino acid substitutions at the acyl-CoA-binding domain interrupt 14[C]palmitoyl-CoA binding of ACBP2, an Arabidopsis acyl-CoA-binding protein with ankyrin repeats.2000 · DOI: 10.1023/a:1026524108095
ACBP4 and ACBP5, novel Arabidopsis acyl-CoA-binding proteins with kelch motifs that bind oleoyl-CoA.2004 · DOI: 10.1007/s11103-004-0642-z
Overexpression of membrane-associated acyl-CoA-binding protein ACBP1 enhances lead tolerance in Arabidopsis.2008 · DOI: 10.1111/j.1365-313x.2008.03402.x
At4g24230 Binds medium- and long-chain acyl-CoA esters with very high affinity.
Arabidopsis ACBP3 is an extracellularly targeted acyl-CoA-binding protein.2006 · DOI: 10.1007/s00425-005-0139-2

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0681900 Binds medium- and long-chain acyl-CoA esters with high affinity.
The rice acyl-CoA-binding protein gene family: phylogeny, expression and functional analysis.2011 · DOI: 10.1111/j.1469-8137.2010.03546.x
Subcellular localization of rice acyl-CoA-binding proteins (ACBPs) indicates that OsACBP6::GFP is targeted to the peroxisomes.2014 · DOI: 10.1111/nph.12809
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_035369 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0001666 response to hypoxia Biological Process
GO:0006629 lipid metabolic process Biological Process
GO:0006869 lipid transport Biological Process
GO:0009409 response to cold Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0010029 regulation of seed germination Biological Process
GO:0010162 seed dormancy process Biological Process
GO:0010288 response to lead ion Biological Process
GO:0048316 seed development Biological Process
GO:0055089 fatty acid homeostasis Biological Process
GO:0055092 sterol homeostasis Biological Process
GO:1900140 regulation of seedling development Biological Process
KEGG gene cross-reference
ath:AT4G27780
ath:AT5G53470
bta:618245
dosa:Os04g0681900
hsa:84320
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.250
Rank 1 · TkA04G137400 · TK1151
Nucleus0.233
Rank 2 · TkA04G137400 · TK1151
Endoplasmic reticulum0.203
Rank 3 · TkA04G137400 · TK1151
Plastid0.155
Rank 4 · TkA04G137400 · TK1151
Golgi apparatus0.154
Rank 5 · TkA04G137400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF285484TM_phosphoesterase7-40 aa
PF00887ACBP110-189 aa
PF12796Ank_2228-301 aa
PF00887ACBP234-252 aa
PF00023Ank241-268 aa
PF24521Ank_KRIT1241-345 aa
PF13637Ank_4242-291 aa
PF13606Ank_3242-256 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G137400PF285484TM_phosphoesterase7400.07114.4
TkA04G137400PF00887ACBP1101899.7e-2690.5
TkA04G137400PF12796Ank_22283015.7e-29101.2
TkA04G137400PF00887ACBP2342529.7e-2690.5
TkA04G137400PF00023Ank2412681.9e-1763.1
TkA04G137400PF24521Ank_KRIT12413450.1212.8
TkA04G137400PF13637Ank_42422917.6e-1968.1
TkA04G137400PF13606Ank_32422562.5e-1143.4
TkA04G137400PF12796Ank_22433345.7e-29101.2
TkA04G137400PF13857Ank_52593111.6e-1454.6
TkA04G137400PF13606Ank_32702982.5e-1143.4
TkA04G137400PF00023Ank2713021.9e-1763.1
TkA04G137400PF13637Ank_42753247.6e-1968.1
TkA04G137400PF23745ANK_LRRK22753260.1812.4
TkA04G137400PF13857Ank_52933431.6e-1454.6
TkA04G137400PF13606Ank_33033282.5e-1143.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SM23Arabidopsis thalianasp|Q9SM23|ACBP1_ARATH Acyl-CoA-binding domain-containing protein 164.400%Swiss-ProtHigh
Q9STP8Arabidopsis thalianasp|Q9STP8|ACBP2_ARATH Acyl-CoA-binding domain-containing protein 260.900%Swiss-ProtHigh
Q9STX1Arabidopsis thalianasp|Q9STX1|ACBP3_ARATH Acyl-CoA-binding domain-containing protein 345.900%Swiss-ProtLow
A3AYR1Oryza sativa subsp. japonicasp|A3AYR1|ACBP4_ORYSJ Acyl-CoA-binding domain-containing protein 450.800%Swiss-ProtHigh

JBrowse

View in Genome Browser