TkA04G126430 | RubberDandelionOmics

Gene overview

TkA04G126430

Reference: TK1151 Chr: Chr04 Coordinates: 32829038-32829713 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

588 bp · TkA04G126430|TK1151|cDNA

ATGGTGGTTCTAGAGAAAAACCCTAATTCCAAAGCTGAAAATGGCGATGGCTCCAACAACAAGAAGAAACGAAAGAGGAACAAGAACAAGAAGAACAATGTAGAGGAAGAGCCTGACATGGCTGCACAAGAACCATCGGAAATCAATGGCAGTGAGAAGGAAGAGGAAGAAGTCACAGCATTGAAAGAATCGAAAAGGAAGAGAAAGAAGAAAGGAAAGAAAGCAAGTGAAGAAGAAGAAAACACAGAGACATATGAAAT...

CDS

Download CDS FASTA

588 bp · TkA04G126430|TK1151|CDS

ATGGTGGTTCTAGAGAAAAACCCTAATTCCAAAGCTGAAAATGGCGATGGCTCCAACAACAAGAAGAAACGAAAGAGGAACAAGAACAAGAAGAACAATGTAGAGGAAGAGCCTGACATGGCTGCACAAGAACCATCGGAAATCAATGGCAGTGAGAAGGAAGAGGAAGAAGTCACAGCATTGAAAGAATCGAAAAGGAAGAGAAAGAAGAAAGGAAAGAAAGCAAGTGAAGAAGAAGAAAACACAGAGACATATGAAAT...

Protein

Download Protein FASTA

195 aa · TkA04G126430|TK1151|PROTEIN

MVVLEKNPNSKAENGDGSNNKKKRKRNKNKKNNVEEEPDMAAQEPSEINGSEKEEEEVTALKESKRKRKKKGKKASEEEENTETYEIKEDEDLNMEEEEEKETETKKKKKVRSSGDSRIMSSDSFTSLPLSEPTKKAIIDMGFQYMTQIQARSIPPLLEGKDVLGAARTGSGKTLAFLIPAVELLYHASIFTTIV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G126430`
TK1151 ID	TkA04G126430
OH-1004 ID	LXL04_035508
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.200
Protein coverage (%)	TK1151 96.923 / OH-1004 30.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G126430

Location Chr04:32829038-32829713 (+)

Description Similar to Os03g0802700: DEAD-box ATP-dependent RNA helicase 27

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18600`	DEAD-box ATP-dependent RNA helicase 51.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0802700`	DEAD-box ATP-dependent RNA helicase 27.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035508 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0048866 stem cell fate specification Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT3G18600

ath:AT5G65900

ddi:DDB_G0282741

dosa:Os03g0802700

dosa:Os06g0535100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · TkA04G126430 · TK1151

Cytoplasm0.065

Rank 2 · TkA04G126430 · TK1151

Cell membrane0.028

Rank 3 · TkA04G126430 · TK1151

Endoplasmic reticulum0.026

Rank 4 · TkA04G126430 · TK1151

Extracellular0.008

Rank 5 · TkA04G126430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27024Phage_T7_kinase6-120 aa

PF01080Presenilin12-107 aa

PF19421Fry_C26-139 aa

PF30856ARM_UBR_1_2_339-149 aa

PF00270DEAD147-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G126430	`PF27024`	Phage_T7_kinase	6	120	7.5	6.3
TkA04G126430	`PF01080`	Presenilin	12	107	5.2	6.4
TkA04G126430	`PF19421`	Fry_C	26	139	7.2	5.6
TkA04G126430	`PF30856`	ARM_UBR_1_2_3	39	149	0.16	10.9
TkA04G126430	`PF00270`	DEAD	147	185	8.6e-12	45.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LIH9`	Arabidopsis thaliana	sp\|Q9LIH9\|RH51_ARATH DEAD-box ATP-dependent RNA helicase 51	79.400%	Swiss-Prot	Low
`Q84T03`	Oryza sativa subsp. japonica	sp\|Q84T03\|RH27_ORYSJ DEAD-box ATP-dependent RNA helicase 27	63.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card