TkA04G111910 | RubberDandelionOmics

Gene overview

TkA04G111910

Reference: TK1151 Chr: Chr04 Coordinates: 29105199-29109043 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1758 bp · TkA04G111910|TK1151|cDNA

CAAGCACAGACTCGTAATTCCGCTGAAGACCGCTGAAGAATCAAGTCGATGCCTCATGCCTTCGTTCTTTGTCTTTGACAATTGACTCCGGCCAATCGATTCTCTGAAAAAACAATTGAAATCTGCTCCTGAAATACCGAATCCCCTGATGTCGATTCCCAAGTAGAATCAAAGCAATTTCATGAAGATGATACAGTGGATCTTGAAAGCCATGAAAACGAGAAGTAAAATCTAGAACAAGTAAAAAGCAATCTGAAGTT...

CDS

Download CDS FASTA

897 bp · TkA04G111910|TK1151|CDS

ATGCCATCTTTACACAAAGCCAAGCTCGATAAACTCCAATCCAAATTAATAATCCTCCAAAACCTCGGCTTCACCTCTTCCGACTTGGTCAAAATCATAAGCTGTAGGCCCCGTTTCCTAAATTCAAGGCTCAACAATTGCCTCGATGAACGTGTCCAATACCTCGAAAACCTTTTCGGATCAAAACAAACCCTCCAAAAAGCCATTCTCAGAAACCCTTCGATTCTAACTTACGATTTAGAAAAATTAATCAAACCCAC...

Protein

Download Protein FASTA

298 aa · TkA04G111910|TK1151|PROTEIN

MPSLHKAKLDKLQSKLIILQNLGFTSSDLVKIISCRPRFLNSRLNNCLDERVQYLENLFGSKQTLQKAILRNPSILTYDLEKLIKPTIELYKSMGISGADLALMLLSRPTIIPRTSLTPEKLDYIRRTGASKDSKMYKYVVTLMAISRTETIREKIANLEKFGFTEDEVFRLIGTSPLLLTLSVDKVQRNMTFVVASMKLPARAVLSHPFLLFNNLEAVMKPRMIVAGKIEDLGLVPRIEGLKIFTALRMTERRFVKAFI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G111910`
TK1151 ID	TkA04G111910
OH-1004 ID	LXL04_011486
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.600
Protein coverage (%)	TK1151 100.000 / OH-1004 75.635 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G111910`
Location	Chr04:29105199-29109043 (+)
Description	Similar to Os05g0404000: Transcription termination factor MTERF4, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011486` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006353 DNA-templated transcription termination Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0008380 RNA splicing Biological Process GO:0009651 response to salt stress Biological Process GO:0009658 chloroplast organization Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process GO:0010343 singlet oxygen-mediated programmed cell death Biological Process GO:0032502 developmental process Biological Process GO:0042254 ribosome biogenesis Biological Process GO:0042793 plastid transcription Biological Process GO:0042794 plastid rRNA transcription Biological Process GO:0048364 root development Biological Process
KEGG gene cross-reference	ath:AT4G02990 ath:AT5G55580 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.821

Rank 1 · TkA04G111910 · TK1151

Plastid0.126

Rank 2 · TkA04G111910 · TK1151

Nucleus0.044

Rank 3 · TkA04G111910 · TK1151

Cytoplasm0.032

Rank 4 · TkA04G111910 · TK1151

Cell membrane0.012

Rank 5 · TkA04G111910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02536mTERF9-46 aa

PF03069FmdA_AmdA15-37 aa

PF23950MLLE_219-31 aa

PF02536mTERF40-255 aa

PF14777BBIP10100-128 aa

PF03069FmdA_AmdA107-181 aa

PF23950MLLE_2153-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G111910	`PF02536`	mTERF	9	46	3.8e-38	131.9
TkA04G111910	`PF03069`	FmdA_AmdA	15	37	0.0031	17.2
TkA04G111910	`PF23950`	MLLE_2	19	31	0.1	13.2
TkA04G111910	`PF02536`	mTERF	40	255	3.8e-38	131.9
TkA04G111910	`PF14777`	BBIP10	100	128	0.089	13.1
TkA04G111910	`PF03069`	FmdA_AmdA	107	181	0.0031	17.2
TkA04G111910	`PF23950`	MLLE_2	153	169	0.1	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card