Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2220 bp · TkA04G109760|TK1151|cDNA
AGAAAATTGAAAAGAAAAAAAAAGCAGAAAAGCAAGGTGAAGAAATAAATGCTCCCACCCATCAGTATGATGATTGAGTTTTTAAAAAAGAAAGTAGAACCAGATGCATCATCTCTCACATCCACAACAGAATTTTTAATTTCCTTTCCTTTTCTTCTTTGCTTTTCCCCTTTTGAACTTTACTAAAATCAGCATACCCCCTTCAACCCTAACAATAATTTTCATTCCATTGTTTCACATTACACGATTTCCCGTTTCTG...
1689 bp · TkA04G109760|TK1151|CDS
ATGATATCAGAAAATCCAACAAATGAAACATCATCACTTCATCAAGAACTCGAAGTACTAACCGTATCAAAACGTCTTGTAAGAAGCCTAAGCCAAAAACTAAAAAGAAAAAACCAAAGCAGTACACCCGATGACGTGGACAACACACGTGGCATTTCAATAAAATGCCCCACCCGTGGCGGCGGCTGCAAGGTCGGAGCCACCACCGGAGACGAATTCTCCGATTGCCGGGGCCGCCCTTCAACTTCCAATGACTATAA...
Protein
Download Protein FASTA562 aa · TkA04G109760|TK1151|PROTEIN
MISENPTNETSSLHQELEVLTVSKRLVRSLSQKLKRKNQSSTPDDVDNTRGISIKCPTRGGGCKVGATTGDEFSDCRGRPSTSNDYKPVCGPDDTTIDCFSYGVKERFWKRSNNRKITEMENTHQHVLFLPDDIVEMCLVKLPLTSLVRVRLVCKKWKVLTTTPRFLEMRRENGYQTPWLFLFGCVKNGICSKEINAFDVSSNKWHKIESEILKGRFMFSVVNIRDDVYIVGGCSSLTNFGRVDRSSVKTHKGVLVFSPL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G109760 |
|---|---|
| TK1151 ID | TkA04G109760 |
| OH-1004 ID | LXL04_035768 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 97.300 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G109760 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:28524905-28527959 (+) | |||||||||
| Description | Similar to At5g42350: F-box/kelch-repeat protein At5g42350 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001558 regulation of cell growth Biological Process GO:0008361 regulation of cell size Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0010017 red or far-red light signaling pathway Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0042742 defense response to bacterium Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0009507 chloroplast Cellular Component GO:0019005 SCF ubiquitin ligase complex Cellular Component GO:0004842 ubiquitin-protein transferase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G30090 ath:AT2G24540 ath:AT5G15710 ath:AT5G42350 ath:AT5G42360 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13418Beta-prop_TYW492-113 aaPF24981Beta-prop_ATRN-LZTR199-117 aaPF12937F-box-like129-164 aaPF00646F-box130-167 aaPF24681Kelch_KLHDC2_KLHL20_DRC7149-233 aaPF13964Beta-prop_Calicin156-237 aaPF07646Kelch_2180-208 aaPF25210Kelch_FKB95181-296 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G109760 | PF13418 | Beta-prop_TYW4 | 92 | 113 | 0.068 | 13.8 |
| TkA04G109760 | PF24981 | Beta-prop_ATRN-LZTR1 | 99 | 117 | 4e-06 | 27.0 |
| TkA04G109760 | PF12937 | F-box-like | 129 | 164 | 1e-05 | 25.9 |
| TkA04G109760 | PF00646 | F-box | 130 | 167 | 1.8e-08 | 34.7 |
| TkA04G109760 | PF24681 | Kelch_KLHDC2_KLHL20_DRC7 | 149 | 233 | 1.9e-11 | 44.4 |
| TkA04G109760 | PF13964 | Beta-prop_Calicin | 156 | 237 | 3e-07 | 30.5 |
| TkA04G109760 | PF07646 | Kelch_2 | 180 | 208 | 0.00068 | 20.2 |
| TkA04G109760 | PF25210 | Kelch_FKB95 | 181 | 296 | 1.7e-07 | 31.9 |
| TkA04G109760 | PF13415 | Beta-prop_FBX42 | 181 | 238 | 0.00016 | 22.1 |
| TkA04G109760 | PF24996 | NANM | 193 | 234 | 0.045 | 13.3 |
| TkA04G109760 | PF01344 | Kelch_1 | 197 | 209 | 5.3e-13 | 48.9 |
| TkA04G109760 | PF13418 | Beta-prop_TYW4 | 197 | 240 | 0.068 | 13.8 |
| TkA04G109760 | PF01344 | Kelch_1 | 216 | 271 | 5.3e-13 | 48.9 |
| TkA04G109760 | PF07646 | Kelch_2 | 219 | 270 | 0.00068 | 20.2 |
| TkA04G109760 | PF01344 | Kelch_1 | 355 | 386 | 5.3e-13 | 48.9 |
| TkA04G109760 | PF13964 | Beta-prop_Calicin | 355 | 406 | 3e-07 | 30.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.