TkA04G098380 | RubberDandelionOmics

Gene overview

TkA04G098380

Reference: TK1151 Chr: Chr04 Coordinates: 25622391-25628457 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4116 bp · TkA04G098380|TK1151|cDNA

TTTACAACTCATAGTCCTCACTCTCTCTCTTTAGAATTATCAAAAGGGAAAGCCTCTCACAGACAGATCCATCAAAGCGATCTGTGTCCCTTCTGTATTACGCGTTGAACTTTCAACGCCTTTCTCTTTCTCTCTCTTAAGAATTTAACACACAACCAGTTGTCTCTGTCGAGATCCCTTCTCCTTCTTCTTTCTACCCTCTGATCGCAAACATTTTCATTTTCTCTCTCAAGAAAAGAATCAATCAATAAATCATAAGT...

CDS

Download CDS FASTA

1830 bp · TkA04G098380|TK1151|CDS

ATGCTTACATTCGAAGCTTTATCAGAGACGTCTGAGTTCGCAAGAAAGTGGGTCCCGTTTTGCAAAAAGTTCAGCATCGAGCCTCGTGCTCCTGAATGGTACTTCGCCCAAAAGGTCGATTATCTTAAAGACAAAGTCCACCCTGCATTTGTACGCGAACGTCGAGCTATGAAGAGAGATTATTATGAGAGTAAGATACGGATCAATGGACTCGTCCAAATGGCGCAGAAGGTTCCGGAAGAAGGATGGACGATGCAAGA...

Protein

Download Protein FASTA

609 aa · TkA04G098380|TK1151|PROTEIN

MLTFEALSETSEFARKWVPFCKKFSIEPRAPEWYFAQKVDYLKDKVHPAFVRERRAMKRDYYESKIRINGLVQMAQKVPEEGWTMQDGTPWPGNNVRDHPGMIQVFLGQNGVRDIEGNELPRLVYVSREKRPGFDHHKKAGAMNALIRVSAVVSNAPYLLNVDCDHYINNSKALRESMCFMMDPTSGKKICYVQFPQRFDGIDRHDRYSNRNVVFFDINMKGLDGIQGPICVGTGCVFRRQALYGFDAPVKKKAPGKTCN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G098380`
TK1151 ID	TkA04G098380
OH-1004 ID	LXL04_030016
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	91.100
Protein coverage (%)	TK1151 97.701 / OH-1004 54.049 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G098380

Location Chr04:25622391-25628457 (+)

Description Similar to CESA6: Cellulose synthase A catalytic subunit 6 [UDP-forming]

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39350`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	Functional analysis of the cellulose synthase genes CesA1, CesA2, and CesA3 in Arabidopsis.2002 · DOI: 10.1104/pp.010931 Knockout of the AtCESA2 gene affects microtubule orientation and causes abnormal cell expansion in Arabidopsis.2007 · DOI: 10.1104/pp.106.088393 Organization of cellulose synthase complexes involved in primary cell wall synthesis in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0706569104
`At2g21770`	Probable catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	No verified direct reference in this release
`At5g64740`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	PROCUSTE1 encodes a cellulose synthase required for normal cell elongation specifically in roots and dark-grown hypocotyls of Arabidopsis.2000 · DOI: 10.1105/tpc.12.12.2409 Resistance against herbicide isoxaben and cellulose deficiency caused by distinct mutations in same cellulose synthase isoform CESA6.2002 · DOI: 10.1104/pp.010822 Genetic evidence for three unique components in primary cell-wall cellulose synthase complexes in Arabidopsis.2007 · DOI: 10.1073/pnas.0706592104 Organization of cellulose synthase complexes involved in primary cell wall synthesis in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0706569104
`At5g09870`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	Organization of cellulose synthase complexes involved in primary cell wall synthesis in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0706569104

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0252400`	Probable catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030016 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009825 multidimensional cell growth Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0009833 plant-type primary cell wall biogenesis Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0010192 mucilage biosynthetic process Biological Process

GO:0010214 seed coat development Biological Process

GO:0030244 cellulose biosynthetic process Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G21770

ath:AT4G39350

ath:AT5G09870

ath:AT5G64740

dosa:Os07g0424400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.695

Rank 1 · TkA04G098380 · TK1151

Endoplasmic reticulum0.189

Rank 2 · TkA04G098380 · TK1151

Cytoplasm0.135

Rank 3 · TkA04G098380 · TK1151

Golgi apparatus0.119

Rank 4 · TkA04G098380 · TK1151

Nucleus0.051

Rank 5 · TkA04G098380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03552Cellulose_synt1-595 aa

PF13632Glyco_trans_2_3174-243 aa

PF13641Glyco_tranf_2_3232-249 aa

PF13632Glyco_trans_2_3377-482 aa

PF13641Glyco_tranf_2_3382-430 aa

PF13564DoxX_2465-525 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G098380	`PF03552`	Cellulose_synt	1	595		1080.0
TkA04G098380	`PF13632`	Glyco_trans_2_3	174	243	9e-08	32.9
TkA04G098380	`PF13641`	Glyco_tranf_2_3	232	249	0.3	11.5
TkA04G098380	`PF13632`	Glyco_trans_2_3	377	482	9e-08	32.9
TkA04G098380	`PF13641`	Glyco_tranf_2_3	382	430	0.3	11.5
TkA04G098380	`PF13564`	DoxX_2	465	525	0.078	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48947`	Arabidopsis thaliana	sp\|O48947\|CESA2_ARATH Cellulose synthase A catalytic subunit 2 [UDP-forming]	82.400%	Swiss-Prot	High
`Q9SJ22`	Arabidopsis thaliana	sp\|Q9SJ22\|CESA9_ARATH Probable cellulose synthase A catalytic subunit 9 [UDP-forming]	80.600%	Swiss-Prot	High
`Q94JQ6`	Arabidopsis thaliana	sp\|Q94JQ6\|CESA6_ARATH Cellulose synthase A catalytic subunit 6 [UDP-forming]	80.500%	Swiss-Prot	High
`Q8L778`	Arabidopsis thaliana	sp\|Q8L778\|CESA5_ARATH Cellulose synthase A catalytic subunit 5 [UDP-forming]	80.400%	Swiss-Prot	High
`Q6YVM4`	Oryza sativa subsp. japonica	sp\|Q6YVM4\|CESA6_ORYSJ Probable cellulose synthase A catalytic subunit 6 [UDP-forming]	81.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card