RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G068350
Reference: TK1151 Chr: Chr04 Coordinates: 18131311-18133333 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1838 bp · TkA04G068350|TK1151|cDNA

GTGAAACAATTTTTCTGTTTAAAAACAATAGTTAATTATCTTATGAGAAAAGAGTCGTAGAGGAATATGGAAATGGAATGTGCTTCTGCTTTAAATTAACCAAATTTAATATCAAGTGTTCAGATTCACTTGGAAGTTAGAACAAACGATTTGTTTTCTTCTTGCTGCTCCTCCTGCTGCTGCATGGAAGAAGAACCAACCTAAATCTGCGGTATTTCTTCTCTTTTTCTCCGTTTTCTGTTCAGCGACCCTCTCTCTCT...

CDS

Download CDS FASTA

933 bp · TkA04G068350|TK1151|CDS

ATGGGGACTCAAACAATGGGATCAAACGGTGCGACACAAAAACCTATGTTCGATGGATTGTCAAGGCAAGGATCTTTGTATAACCTAACTCTAGACGAAGTTCAGCAGCAATTAGGAGATTTAGGGAAACCTTTCAGTAGTATGAATCTCGATGAGTTTCTCAAAAACGTTTGGTCAGCTGAAGCTAATCAAGGAACGAACAGTACCTCCCCTGAACTCACCCAACTTGCTTCAGCTTCATCGTTACCCAGACAACTAAG...

Protein

Download Protein FASTA

310 aa · TkA04G068350|TK1151|PROTEIN

MGTQTMGSNGATQKPMFDGLSRQGSLYNLTLDEVQQQLGDLGKPFSSMNLDEFLKNVWSAEANQGTNSTSPELTQLASASSLPRQLSLNFTKDLTKKTVDQVWQDIQHSQKKNNGNESETNINSSSSCKRQPTLGEMTLEDFLVKAGIVAESSPTEKNQEQNLDQQWMHYQIPQIQQQHVVMSGHYQAPQPINVAGNPMIDSTGYLETRMTMSPPPLMGNVSDFGRKRPPSGDVVEKTVERRQKRMIKNRESAARSRARK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G068350
TK1151 IDTkA04G068350
OH-1004 IDLXL04_036189
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G068350
LocationChr04:18131311-18133333 (+)
DescriptionSimilar to DPBF3: ABSCISIC ACID-INSENSITIVE 5-like protein 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g56850 Binds to the embryo specification element and the ABA-responsive element (ABRE) of the Dc3 gene promoter. No verified direct reference in this release
At2g41070 Binds to the embryo specification element and the ABA-responsive element (ABRE) of the Dc3 gene promoter and to the ABRE of the Em1 gene promoter. No verified direct reference in this release
At1g49720 Binds to the ABA-responsive element (ABRE). No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0859300 May act as a transcription factor with transactivation activity observed in yeast.
A bZIP transcription factor, OsABI5, is involved in rice fertility and stress tolerance.2008 · DOI: 10.1007/s11103-008-9298-4
Phosphorylation-mediated regulation of a rice ABA responsive element binding factor.2011 · DOI: 10.1016/j.phytochem.2010.10.005
A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth.2012 · DOI: 10.1093/jxb/err338
Os08g0472000 Transcription activator that mediates abscisic acid (ABA) signaling. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036189 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009409 response to cold Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process
GO:0009845 seed germination Biological Process
GO:0010115 regulation of abscisic acid biosynthetic process Biological Process
GO:0010152 pollen maturation Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
KEGG gene cross-reference
ath:AT2G41070
ath:AT3G56850
dosa:Os01g0859300
dosa:Os06g0211200
dosa:Os08g0472000
osa:4325061
osa:4340462
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.946
Rank 1 · TkA04G068350 · TK1151
Cytoplasm0.159
Rank 2 · TkA04G068350 · TK1151
Cell membrane0.028
Rank 3 · TkA04G068350 · TK1151
Endoplasmic reticulum0.013
Rank 4 · TkA04G068350 · TK1151
Mitochondrion0.010
Rank 5 · TkA04G068350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03131bZIP_Maf26-38 aa
PF03131bZIP_Maf93-109 aa
PF19776DUF626295-113 aa
PF01166TSC2297-122 aa
PF19776DUF6262235-286 aa
PF07716bZIP_2238-285 aa
PF00170bZIP_1241-286 aa
PF03131bZIP_Maf241-287 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G068350PF03131bZIP_Maf26380.0009420.4
TkA04G068350PF03131bZIP_Maf931090.0009420.4
TkA04G068350PF19776DUF6262951130.4611.4
TkA04G068350PF01166TSC22971220.2312.4
TkA04G068350PF19776DUF62622352860.4611.4
TkA04G068350PF07716bZIP_22382851.6e-1041.6
TkA04G068350PF00170bZIP_12412868.2e-1452.2
TkA04G068350PF03131bZIP_Maf2412870.0009420.4
TkA04G068350PF27868Lepto_lipo2462860.08613.3
TkA04G068350PF01166TSC222652840.2312.4
TkA04G068350PF07558Shugoshin_N2662840.02215.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LES3Arabidopsis thalianasp|Q9LES3|AI5L2_ARATH ABSCISIC ACID-INSENSITIVE 5-like protein 250.300%Swiss-ProtHigh
Q9C5Q2Arabidopsis thalianasp|Q9C5Q2|AI5L3_ARATH ABSCISIC ACID-INSENSITIVE 5-like protein 346.800%Swiss-ProtMedium
Q9M7Q5Arabidopsis thalianasp|Q9M7Q5|AI5L4_ARATH ABSCISIC ACID-INSENSITIVE 5-like protein 434.200%Swiss-ProtMedium
Q8RZ35Oryza sativa subsp. japonicasp|Q8RZ35|ABI5_ORYSJ bZIP transcription factor ABI5 homolog37.100%Swiss-ProtMedium
Q6ZDF3Oryza sativa subsp. japonicasp|Q6ZDF3|TRAB1_ORYSJ bZIP transcription factor TRAB136.200%Swiss-ProtMedium

JBrowse

View in Genome Browser