Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1446 bp · TkA04G068310|TK1151|cDNA
ATGGTGGGCTCCTATAAGTTGGAACAGATGATGAACGTAGCTATTAAAAATAAGGAGTTAAGCCCATACCCTATTAAATTAACGACGTCAAAATCATCCCAGCAATCAGCCAGGATTTCACTATGTCGCGCTTATGACTTTCCGCAGCCGATCACCACCCACTCAACAACGTCTACAACCTTGGCGCTTCCTGTGTCGACGACGGCAACGTCGATCTCTCCCAAACTTGTCCCCCAAACCCTAGAGATTAAGGAAGGGAT...
1446 bp · TkA04G068310|TK1151|CDS
ATGGTGGGCTCCTATAAGTTGGAACAGATGATGAACGTAGCTATTAAAAATAAGGAGTTAAGCCCATACCCTATTAAATTAACGACGTCAAAATCATCCCAGCAATCAGCCAGGATTTCACTATGTCGCGCTTATGACTTTCCGCAGCCGATCACCACCCACTCAACAACGTCTACAACCTTGGCGCTTCCTGTGTCGACGACGGCAACGTCGATCTCTCCCAAACTTGTCCCCCAAACCCTAGAGATTAAGGAAGGGAT...
Protein
Download Protein FASTA481 aa · TkA04G068310|TK1151|PROTEIN
MVGSYKLEQMMNVAIKNKELSPYPIKLTTSKSSQQSARISLCRAYDFPQPITTHSTTSTTLALPVSTTATSISPKLVPQTLEIKEGISSFTASIYLLPKTLYRFPSTKRVHSFLLEISTISIWCLICFETKVVIDDKSARKPGTVEGVNDTKDCSFITPNNSDDALFVHISSITTDGFGNLNDGETMVIHKADGRANTTNASRYVEGHVQERGCAVVNTGHIEVKNAKNDYGEEQVTEIELIQSFDGRVAVVKKFGEVEN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G068310 |
|---|---|
| TK1151 ID | TkA04G068310 |
| OH-1004 ID | LXL04_024042 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 27.800 |
| Protein coverage (%) | TK1151 96.050 / OH-1004 39.061Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G068310 |
|---|---|
| Location | Chr04:18117483-18118928 (-) |
| Description | Similar to ASA1: Anthranilate synthase alpha subunit 1, chloroplastic |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000162 L-tryptophan biosynthetic process Biological Process GO:0009611 response to wounding Biological Process GO:0009617 response to bacterium Biological Process GO:0009723 response to ethylene Biological Process GO:0009851 auxin biosynthetic process Biological Process GO:0010311 lateral root formation Biological Process GO:0010600 regulation of auxin biosynthetic process Biological Process GO:0005634 nucleus Cellular Component GO:0005950 anthranilate synthase complex Cellular Component GO:0009507 chloroplast Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0004049 anthranilate synthase activity Molecular Function |
| KEGG gene cross-reference | ath:AT2G29690 ath:AT5G05730 dosa:Os03g0264400 dosa:Os03g0826500 osa:4332341 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00313CSD143-186 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G068310 | PF00313 | CSD | 143 | 186 | 7.1e-08 | 32.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.