TkA04G052870 | RubberDandelionOmics

Gene overview

TkA04G052870

Reference: TK1151 Chr: Chr04 Coordinates: 14167744-14176247 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1513 bp · TkA04G052870|TK1151|cDNA

ACATACTTGGTTTTTAATCAAATTTAAATTTAGAAAATTGTCAAGTAACCAAATACCTAAATAAAATACGATTTTAAAATCGGGGATCATATTTTAAAGATTTGATAGATGGGGACAGAAAAGAAAATGGCGACTCTTGCTCTCTGAATTTTCTACTGTATGCGGGTTCATTAGATTATACATTCGGACAATGTGCTTGATTATCGCAGCTAGAAATCGCCAACAATAGTGGTTACAAAGACAACAAAAACACCCAGTTT...

CDS

Download CDS FASTA

1200 bp · TkA04G052870|TK1151|CDS

ATGGATCAAGATCCTAACACCCCTCCACCAAACCAAAACCAACAATCTTTGGGATTTTCCCAATTTGCCCAAACACCCGAATTTAGAGAATTAATTTCTGTGTTAAGGCAAGGAGGATTGTCACCAAATATACCCAATCAACGCCAATTTACTCCAACTGTATCACCTACTATACCCTTCCAAAACCTCCAACAAAACTTCAGTCCCCACGCCATTTACAACCAAAACTTTAACGACCCACGAGCATTTGCACAACACGA...

Protein

Download Protein FASTA

400 aa · TkA04G052870|TK1151|PROTEIN

MDQDPNTPPPNQNQQSLGFSQFAQTPEFRELISVLRQGGLSPNIPNQRQFTPTVSPTIPFQNLQQNFSPHAIYNQNFNDPRAFAQHEFQNPNFYGGGSSSAQYPQNETQMPLTHEVFPETQMPPSQETVPETQRPRREPKNKQKAPTTRRGKTKPSMEIQDDKIPWTEDERIALADAWCSTSQNPTQGNDQNKATYWQSIRAKLANTMGRDENYRSTNSITSKWTLMKTQLTKFNGIYMRLSRNPPSGWNEMKILDEAVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G052870`
TK1151 ID	TkA04G052870
OH-1004 ID	LXL04_037050
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	50.800
Protein coverage (%)	TK1151 97.000 / OH-1004 25.469 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G052870

Location Chr04:14167744-14176247 (-)

Description Similar to ATG18A: Autophagy-related protein 18a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58040`	E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins.	TRAF Family Proteins Regulate Autophagy Dynamics by Modulating AUTOPHAGY PROTEIN6 Stability in Arabidopsis.2017 · DOI: 10.1105/tpc.17.00056 SINAT E3 Ubiquitin Ligases Mediate FREE1 and VPS23A Degradation to Modulate Abscisic Acid Signaling.2020 · DOI: 10.1105/tpc.20.00267
`At2g41980`	E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins.	TRAF Family Proteins Regulate Autophagy Dynamics by Modulating AUTOPHAGY PROTEIN6 Stability in Arabidopsis.2017 · DOI: 10.1105/tpc.17.00056 SINAT E3 Ubiquitin Ligases Mediate FREE1 and VPS23A Degradation to Modulate Abscisic Acid Signaling.2020 · DOI: 10.1105/tpc.20.00267 SINAT E3 ligases regulate the stability of the ESCRT component FREE1 in response to iron deficiency in plants.2020 · DOI: 10.1111/jipb.13005
`At3g61790`	E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins.	SINAT E3 Ubiquitin Ligases Mediate FREE1 and VPS23A Degradation to Modulate Abscisic Acid Signaling.2020 · DOI: 10.1105/tpc.20.00267
`At5g53360`	E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins.	SINAT5 promotes ubiquitin-related degradation of NAC1 to attenuate auxin signals.2002 · DOI: 10.1038/nature00998 SINAT E3 ligases regulate the stability of the ESCRT component FREE1 in response to iron deficiency in plants.2020 · DOI: 10.1111/jipb.13005

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0356414`	E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins.	The SINA E3 ligase OsDIS1 negatively regulates drought response in rice.2011 · DOI: 10.1104/pp.111.180893

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037050 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0000422 autophagy of mitochondrion Biological Process

GO:0000425 pexophagy Biological Process

GO:0006914 autophagy Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010508 positive regulation of autophagy Biological Process

GO:0015031 protein transport Biological Process

KEGG gene cross-reference

ath:AT2G40810

ath:AT3G56440

ath:AT3G62770

ath:AT5G05150

xla:447310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · TkA04G052870 · TK1151

Cytoplasm0.151

Rank 2 · TkA04G052870 · TK1151

Mitochondrion0.015

Rank 3 · TkA04G052870 · TK1151

Cell membrane0.012

Rank 4 · TkA04G052870 · TK1151

Extracellular0.007

Rank 5 · TkA04G052870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14303NAM-associated105-215 aa

PF13837Myb_DNA-bind_4165-235 aa

PF05880Fiji_64_capsid183-280 aa

PF14303NAM-associated270-396 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G052870	`PF14303`	NAM-associated	105	215	4.3e-05	25.1
TkA04G052870	`PF13837`	Myb_DNA-bind_4	165	235	0.00016	22.7
TkA04G052870	`PF05880`	Fiji_64_capsid	183	280	0.15	11.0
TkA04G052870	`PF14303`	NAM-associated	270	396	4.3e-05	25.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2P4`	Arabidopsis thaliana	sp\|Q9M2P4\|SINA2_ARATH E3 ubiquitin-protein ligase SINAT2	71.700%	Swiss-Prot	High
`P93748`	Arabidopsis thaliana	sp\|P93748\|SINA1_ARATH Putative E3 ubiquitin-protein ligase SINAT1	77.200%	Swiss-Prot	High
`Q84JL3`	Arabidopsis thaliana	sp\|Q84JL3\|SINA3_ARATH E3 ubiquitin-protein ligase SINAT3	74.300%	Swiss-Prot	High
`Q8S3N1`	Arabidopsis thaliana	sp\|Q8S3N1\|SINA5_ARATH E3 ubiquitin-protein ligase SINAT5	72.400%	Swiss-Prot	High
`Q10L91`	Oryza sativa subsp. japonica	sp\|Q10L91\|DIS1_ORYSJ E3 ubiquitin-protein ligase DIS1	71.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card