TkA04G050020 | RubberDandelionOmics

Gene overview

TkA04G050020

Reference: TK1151 Chr: Chr04 Coordinates: 13406704-13407222 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

519 bp · TkA04G050020|TK1151|cDNA

ATGCAAATACTGTTAAAGCATCAAAATAAAACAACACATTGCCCACTACTTCGCTCTTTATCGACCCTGGTAAACCCTAACTCATTTCTACACATCAATTCCAGCTCCTTGGGTAACGTTTCAGCTCTTGATCATCACAAAGACAATCACTTACAGCTGACCGATCTAGATCTCTTGGTTCAGTTACAGCACAGTTCTCATGGGTCCGTTTGTAGTTCATACGCTCTCAACAAAGTTATATCCTCCTGCGCAACATCAAG...

CDS

Download CDS FASTA

519 bp · TkA04G050020|TK1151|CDS

ATGCAAATACTGTTAAAGCATCAAAATAAAACAACACATTGCCCACTACTTCGCTCTTTATCGACCCTGGTAAACCCTAACTCATTTCTACACATCAATTCCAGCTCCTTGGGTAACGTTTCAGCTCTTGATCATCACAAAGACAATCACTTACAGCTGACCGATCTAGATCTCTTGGTTCAGTTACAGCACAGTTCTCATGGGTCCGTTTGTAGTTCATACGCTCTCAACAAAGTTATATCCTCCTGCGCAACATCAAG...

Protein

Download Protein FASTA

172 aa · TkA04G050020|TK1151|PROTEIN

MQILLKHQNKTTHCPLLRSLSTLVNPNSFLHINSSSLGNVSALDHHKDNHLQLTDLDLLVQLQHSSHGSVCSSYALNKVISSCATSRSLYTGIQIHSFTIKMGFCSHVYISTALVDMYGKCGVISDAQNLFDETPHRNVITWNSLISGYLHTQFVDVSIDLFVAILRLGIHP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G050020`
TK1151 ID	TkA04G050020
OH-1004 ID	LXL04_015711
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	41.800
Protein coverage (%)	TK1151 56.977 / OH-1004 14.286 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G050020

Location Chr04:13406704-13407222 (-)

Description Similar to LOI1: Pentatricopeptide repeat-containing protein At4g14850

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g13600`	Pentatricopeptide repeat-containing protein At2g13600.	No verified direct reference in this release
`At4g14850`	Acts as a regulatory factor of isoprenoid biosynthesis.	Lovastatin insensitive 1, a Novel pentatricopeptide repeat protein, is a potential regulatory factor of isoprenoid biosynthesis in Arabidopsis.2007 · DOI: 10.1093/pcp/pcm005
`At4g25270`	Pentatricopeptide repeat-containing protein At4g25270, chloroplastic.	No verified direct reference in this release
`At4g30700`	Pentatricopeptide repeat-containing protein At4g30700.	No verified direct reference in this release
`At1g11290`	Involved in multiple sites RNA editing events in chloroplasts.	Pentatricopeptide repeat proteins with the DYW motif have distinct molecular functions in RNA editing and RNA cleavage in Arabidopsis chloroplasts.2009 · DOI: 10.1105/tpc.108.064667

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015711 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0016125 sterol metabolic process Biological Process

GO:0016556 mRNA modification Biological Process

GO:0019287 isopentenyl diphosphate biosynthetic process, mevalonate pathway Biological Process

GO:0019288 isopentenyl diphosphate biosynthetic process, methylerythritol 4-phosphate pathway Biological Process

GO:0048364 root development Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G11290

ath:AT4G14850

ath:AT5G09950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.601

Rank 1 · TkA04G050020 · TK1151

Plastid0.217

Rank 2 · TkA04G050020 · TK1151

Nucleus0.053

Rank 3 · TkA04G050020 · TK1151

Cytoplasm0.041

Rank 4 · TkA04G050020 · TK1151

Cell membrane0.005

Rank 5 · TkA04G050020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01535PPR77-85 aa

PF13041PPR_2111-138 aa

PF01535PPR112-133 aa

PF12854PPR_1112-133 aa

PF13041PPR_2137-172 aa

PF12854PPR_1137-149 aa

PF01535PPR140-170 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G050020	`PF01535`	PPR	77	85	2.4e-07	31.2
TkA04G050020	`PF13041`	PPR_2	111	138	5.4e-06	27.1
TkA04G050020	`PF01535`	PPR	112	133	2.4e-07	31.2
TkA04G050020	`PF12854`	PPR_1	112	133	8.3e-06	26.1
TkA04G050020	`PF13041`	PPR_2	137	172	5.4e-06	27.1
TkA04G050020	`PF12854`	PPR_1	137	149	8.3e-06	26.1
TkA04G050020	`PF01535`	PPR	140	170	2.4e-07	31.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIT7`	Arabidopsis thaliana	sp\|Q9SIT7\|PP151_ARATH Pentatricopeptide repeat-containing protein At2g13600	41.000%	Swiss-Prot	Medium
`Q0WSH6`	Arabidopsis thaliana	sp\|Q0WSH6\|PP312_ARATH Pentatricopeptide repeat-containing protein At4g14850	40.600%	Swiss-Prot	Medium
`Q9SB36`	Arabidopsis thaliana	sp\|Q9SB36\|PP337_ARATH Pentatricopeptide repeat-containing protein At4g25270, chloroplastic	38.400%	Swiss-Prot	Medium
`Q9SUH6`	Arabidopsis thaliana	sp\|Q9SUH6\|PP341_ARATH Pentatricopeptide repeat-containing protein At4g30700	41.100%	Swiss-Prot	Medium
`Q3E6Q1`	Arabidopsis thaliana	sp\|Q3E6Q1\|PPR32_ARATH Pentatricopeptide repeat-containing protein At1g11290, chloroplastic	39.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card