RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_015711
Reference: OH-1004 Chr: Chr03 Coordinates: 81291529-81294057 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2061 bp · LXL04_015711|LXL04_015711|OH1004|cDNA

ATGGTCTCCGCCACCATCAATACCCTCGCCTCGCTGCTTCAATCAGCCGTCTCATCCCGTTCCTCCGTCGTTGGTCGGGCAACGCACGCCAGGATCATCAAAACCATTGACTTTCCCTTTCCTACCTTCATCTGCAACCATCTCGTAAACATGTATTCCAAGCTCGACCTCCTCCATTCAGCCGAACTCCTGCTCTCTCTCATGCCTGCACAAGATCGTTCCGTCGTTACCTGGACCGCCCTCATTTCCGGCTCTGTCCA...

CDS

Download CDS FASTA

2061 bp · LXL04_015711|LXL04_015711|OH1004|CDS

ATGGTCTCCGCCACCATCAATACCCTCGCCTCGCTGCTTCAATCAGCCGTCTCATCCCGTTCCTCCGTCGTTGGTCGGGCAACGCACGCCAGGATCATCAAAACCATTGACTTTCCCTTTCCTACCTTCATCTGCAACCATCTCGTAAACATGTATTCCAAGCTCGACCTCCTCCATTCAGCCGAACTCCTGCTCTCTCTCATGCCTGCACAAGATCGTTCCGTCGTTACCTGGACCGCCCTCATTTCCGGCTCTGTCCA...

Protein

Download Protein FASTA

686 aa · LXL04_015711|LXL04_015711|OH1004|PROTEIN

MVSATINTLASLLQSAVSSRSSVVGRATHARIIKTIDFPFPTFICNHLVNMYSKLDLLHSAELLLSLMPAQDRSVVTWTALISGSVQNGHFSSAILHFRNMHHDSIPPNDFTFPCAFKACNSLRSPVTGRQLHGLSIKAGQIHDVFVGCSAFDMYSKLGLKDDANKMFDEMPEKNLATWNAYISNAVLDGKPRKAIDAFIQSRRLGGEPSSITFCVVLNACSDALNLQIGKQVHGFVIRYGYEHHVSVANGLIDFYGKCK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_015711
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_015711
LocationChr03:81291529-81294057 (+)
DescriptionSimilar to LOI1: Pentatricopeptide repeat-containing protein At4g14850
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g14850 Acts as a regulatory factor of isoprenoid biosynthesis.
Lovastatin insensitive 1, a Novel pentatricopeptide repeat protein, is a potential regulatory factor of isoprenoid biosynthesis in Arabidopsis.2007 · DOI: 10.1093/pcp/pcm005
At5g09950 Putative pentatricopeptide repeat-containing protein At5g09950. No verified direct reference in this release
At1g11290 Involved in multiple sites RNA editing events in chloroplasts.
Pentatricopeptide repeat proteins with the DYW motif have distinct molecular functions in RNA editing and RNA cleavage in Arabidopsis chloroplasts.2009 · DOI: 10.1105/tpc.108.064667
At3g12770 Pentatricopeptide repeat-containing protein At3g12770. No verified direct reference in this release
At3g24000 Pentatricopeptide repeat-containing protein At3g24000, mitochondrial. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_015711 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006397 mRNA processing Biological Process
GO:0009451 RNA modification Biological Process
GO:0016125 sterol metabolic process Biological Process
GO:0016556 mRNA modification Biological Process
GO:0019287 isopentenyl diphosphate biosynthetic process, mevalonate pathway Biological Process
GO:0019288 isopentenyl diphosphate biosynthetic process, methylerythritol 4-phosphate pathway Biological Process
GO:0048364 root development Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0000166 nucleotide binding Molecular Function
GO:0003723 RNA binding Molecular Function
GO:0003729 mRNA binding Molecular Function
KEGG gene cross-reference
ath:AT1G11290
ath:AT4G14850
ath:AT5G09950
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.585
Rank 1 · LXL04_015711 · OH-1004
Plastid0.252
Rank 2 · LXL04_015711 · OH-1004
Nucleus0.059
Rank 3 · LXL04_015711 · OH-1004
Cytoplasm0.036
Rank 4 · LXL04_015711 · OH-1004
Peroxisome0.006
Rank 5 · LXL04_015711 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_274-120 aa
PF13041.13PPR_2175-222 aa
PF01535.27PPR351-377 aa
PF13041.13PPR_2377-409 aa
PF13812.13PPR_3377-425 aa
PF01535.27PPR379-405 aa
PF20431.5E_motif496-557 aa
PF14432.13DYW_deaminase594-686 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_015711PF13041.13PPR_2741202.1e-45153.3
LXL04_015711PF13041.13PPR_21752222.1e-45153.3
LXL04_015711PF01535.27PPR3513771.7e-44147.7
LXL04_015711PF13041.13PPR_23774092.1e-45153.3
LXL04_015711PF13812.13PPR_33774254.3e-2175.5
LXL04_015711PF01535.27PPR3794051.7e-44147.7
LXL04_015711PF20431.5E_motif4965579.7e-2174.5
LXL04_015711PF14432.13DYW_deaminase5946863.2e-36123.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q0WSH6Arabidopsis thalianaPentatricopeptide repeat-containing protein At4g1485062.903%Swiss-Protstrong database homology
Q9FIB2Arabidopsis thalianaPutative pentatricopeptide repeat-containing protein At5g0995040.030%Swiss-Protmoderate database homology
Q3E6Q1Arabidopsis thalianaPentatricopeptide repeat-containing protein At1g11290, chloroplastic38.612%Swiss-Protmoderate database homology
Q9LTV8Arabidopsis thalianaPentatricopeptide repeat-containing protein At3g1277037.113%Swiss-Protmoderate database homology
Q9LIQ7Arabidopsis thalianaPentatricopeptide repeat-containing protein At3g24000, mitochondrial39.587%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser