TkA04G035990 | RubberDandelionOmics

Gene overview

TkA04G035990

Reference: TK1151 Chr: Chr04 Coordinates: 9661490-9666428 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3108 bp · TkA04G035990|TK1151|cDNA

CTAAATACCCCATTTCACGTTTTCACCTCCAAAATTTTAGGGCCCTTTGAAAAACTTCAAATTTTAATCTAAAAACAATCAAAGTATTCAGTTCAAAGATTCAGAAAACACACATCTTCCCTCTCTCCCCATTTCGCTATTCCGAGCTCCAATTAGGACGGATCTGGTCACTCGGCGATTCATCTCAATCGCATACCAAGGTACCACAATTCCAAGCATGATTCACACTTCAATCCTGTAGTTCCGTGTAAAATTTTCGA...

CDS

Download CDS FASTA

1749 bp · TkA04G035990|TK1151|CDS

ATGGTCCGAGAACACAGTATCGAATCCTTTTATGGTAAATTGAGGGAGTCTACTTTAGCGTCAGCTTATAGTCCTCTGCTCATCTTCCCATCCACTTCCGATGTAGATTCTCTTTGCGCTTTGAAAATTATAGGTCGTGTTCTAGAATCAGATTCCGTTAGATACGCTTGCTACCCTGTTTCCAGTTTCAAGGAGATTCATAAGTACGCCGGTCCTAGCTTGTCATCTTCATCTGATACTCCAATCACTATACTCCTCAT...

Protein

Download Protein FASTA

582 aa · TkA04G035990|TK1151|PROTEIN

MVREHSIESFYGKLRESTLASAYSPLLIFPSTSDVDSLCALKIIGRVLESDSVRYACYPVSSFKEIHKYAGPSLSSSSDTPITILLINWGCHRDLKKILEIGPAARVFVVDSHRPIHLHNLSHQNDRVVVLYTGDDENQGDLSYDFDVSALAAASDLNSDDEDDSDSDDENESDGDEDGNRKKRRLSEDGETDPLKLFRKLKKEYYHMGSFHGKPSGCLMYELSHYLRKNTNDLLWLACVSLTDQFVHERLTNERYQAGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G035990`
TK1151 ID	TkA04G035990
OH-1004 ID	LXL04_036574
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G035990`
Location	Chr04:9661490-9666428 (-)
Description	Similar to sna41: Cell division control protein 45 homolog (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036574` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000076 DNA replication checkpoint signaling Biological Process GO:0000727 double-strand break repair via break-induced replication Biological Process GO:0006260 DNA replication Biological Process GO:0006270 DNA replication initiation Biological Process GO:0031573 mitotic intra-S DNA damage checkpoint signaling Biological Process GO:1902977 mitotic DNA replication preinitiation complex assembly Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005694 chromosome Cellular Component GO:0005813 centrosome Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	ddi:DDB_G0267748 hsa:8318 mmu:12544 spo:2542266 xla:398081 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.890

Rank 1 · TkA04G035990 · TK1151

Cytoplasm0.187

Rank 2 · TkA04G035990 · TK1151

Cell membrane0.026

Rank 3 · TkA04G035990 · TK1151

Mitochondrion0.023

Rank 4 · TkA04G035990 · TK1151

Endoplasmic reticulum0.016

Rank 5 · TkA04G035990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02724CDC4527-188 aa

PF09220LA-virus_coat87-164 aa

PF06524NOA36134-183 aa

PF04546Sigma70_ner158-212 aa

PF02724CDC45191-580 aa

PF09220LA-virus_coat337-369 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G035990	`PF02724`	CDC45	27	188	4.2e-161	538.1
TkA04G035990	`PF09220`	LA-virus_coat	87	164	0.0032	16.6
TkA04G035990	`PF06524`	NOA36	134	183	2.6	8.1
TkA04G035990	`PF04546`	Sigma70_ner	158	212	0.22	12.1
TkA04G035990	`PF02724`	CDC45	191	580	4.2e-161	538.1
TkA04G035990	`PF09220`	LA-virus_coat	337	369	0.0032	16.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card