LXL04_036574 | RubberDandelionOmics

Gene overview

LXL04_036574

Reference: OH-1004 Chr: Chr08 Coordinates: 44804842-44806590 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1749 bp · LXL04_036574|LXL04_036574|OH1004|cDNA

ATGGTCCGAGAACACAGTATCGAATCCTTTTATGGTAAATTGAGGGAGTCTACTTTAGCGTCAGCTTATAGTCCTCTGCTCATCTTCCCATCCACTTCCGATGTAGATTCTCTTTGCGCTTTGAAAATTATAGGTCGTGTTCTAGAATCAGATTCCGTTAGATACGCTTGCTACCCTGTTTCCAGTTTCAAGGAGATTCATAAGTACGCCGGTCCTAGCTTGTCATCTTCATCTGATACTCCAATCACTATACTCCTCAT...

CDS

Download CDS FASTA

1749 bp · LXL04_036574|LXL04_036574|OH1004|CDS

ATGGTCCGAGAACACAGTATCGAATCCTTTTATGGTAAATTGAGGGAGTCTACTTTAGCGTCAGCTTATAGTCCTCTGCTCATCTTCCCATCCACTTCCGATGTAGATTCTCTTTGCGCTTTGAAAATTATAGGTCGTGTTCTAGAATCAGATTCCGTTAGATACGCTTGCTACCCTGTTTCCAGTTTCAAGGAGATTCATAAGTACGCCGGTCCTAGCTTGTCATCTTCATCTGATACTCCAATCACTATACTCCTCAT...

Protein

Download Protein FASTA

582 aa · LXL04_036574|LXL04_036574|OH1004|PROTEIN

MVREHSIESFYGKLRESTLASAYSPLLIFPSTSDVDSLCALKIIGRVLESDSVRYACYPVSSFKEIHKYAGPSLSSSSDTPITILLINWGCHRDLKKILEIGPAARVFVVDSHRPIHLHNLSHQNDRVVVLYTGDDENQGDLSYDFDVSALAAASDLNSDDEDDSDSDDENESDGDEDGNRKKRRLSEDGETDPLKLFRKLKKEYYHMGSFHGKPSGCLMYELSHYLRKNTNDLLWLACVSLTDQFVHERLTNERYQAGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036574`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_036574`
Location	Chr08:44804842-44806590 (+)
Description	Similar to sna41: Cell division control protein 45 homolog (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036574` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000076 DNA replication checkpoint signaling Biological Process GO:0000727 double-strand break repair via break-induced replication Biological Process GO:0006260 DNA replication Biological Process GO:0006270 DNA replication initiation Biological Process GO:0031573 mitotic intra-S DNA damage checkpoint signaling Biological Process GO:1902977 mitotic DNA replication preinitiation complex assembly Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005694 chromosome Cellular Component GO:0005813 centrosome Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	ddi:DDB_G0267748 hsa:8318 mmu:12544 spo:2542266 xla:398081 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.890

Rank 1 · LXL04_036574 · OH-1004

Cytoplasm0.187

Rank 2 · LXL04_036574 · OH-1004

Cell membrane0.026

Rank 3 · LXL04_036574 · OH-1004

Mitochondrion0.023

Rank 4 · LXL04_036574 · OH-1004

Endoplasmic reticulum0.016

Rank 5 · LXL04_036574 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02724.20CDC4527-188 aa

PF02724.20CDC45191-580 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036574	`PF02724.20`	CDC45	27	188	4.2e-161	538.1
LXL04_036574	`PF02724.20`	CDC45	191	580	4.2e-161	538.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card