RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G029410
Reference: TK1151 Chr: Chr04 Coordinates: 7754281-7760713 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2694 bp · TkA04G029410|TK1151|cDNA

TCTAGACAAAATTCAGATTTTTTTTTTTTTCATATAAAACTCAAAGATTACATTATTAATGGTTTAGACGCAGCCTTACGGAACATATGGTCAAATTCGGGAAAATGTTTTTTCTTGATTATTTTTTGCGAGATTAGTATATGATGAGATGGGTCAAATTCCCTAACAAACTTATGAAGCAACAAAAGTGTAGGTGACTACTTCTCTCTTAGCGTAAAAAGTCAAGTTGGACATGGTAGGGATGTTCCTGGAGGCAAATT...

CDS

Download CDS FASTA

1959 bp · TkA04G029410|TK1151|CDS

ATGGCAAAGATTTCAACAGGAAATGGTAAATTGACGGATCTGTCCCCGGAGGAAGAAAAGCAAGTGATATCAGACTTTGCAAGAAAAGGCGAAGCTGAAGCCAAAGAAGGGGACACCTTCTATGTACTTTCTTTGAGATGGTGGCGAAGTTGGTCTGCATTTGTTAATCAAATCCCACCAATTACCACAACCGATGGATCATCTCAGATTATAAGCAGACCACCAAGCATTGACAATTCTAATTTGATCTGTGAATCATC...

Protein

Download Protein FASTA

652 aa · TkA04G029410|TK1151|PROTEIN

MAKISTGNGKLTDLSPEEEKQVISDFARKGEAEAKEGDTFYVLSLRWWRSWSAFVNQIPPITTTDGSSQIISRPPSIDNSNLICESSSTLEIDDTLVEGTDYILVPQDIWNQFYTWYGGGPALGRKVITRGSSQSELTVEVYPLRLQLHFVPTVDHYSIKISRKETIGALHQKACEIFHLTPYQVRIWDYYGHKKHALLNNLNQTLDDANIQMDQEILVEVIAHNGRRHTTAIQQNGSAKNGPFPILESSRKNLSQFQNL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G029410
TK1151 IDTkA04G029410
OH-1004 IDLXL04_019075
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)47.300
Protein coverage (%)TK1151 98.006 / OH-1004 72.394
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G029410
LocationChr04:7754281-7760713 (+)
DescriptionSimilar to UBP5: Ubiquitin carboxyl-terminal hydrolase 5
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g40930 Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.
Ubiquitin-specific proteases from Arabidopsis thaliana: cloning of AtUBP5 and analysis of substrate specificity of AtUBP3, AtUBP4, and AtUBP5 using Escherichia coli in vivo and in vitro assays.2000 · DOI: 10.1006/abbi.2000.1874
At4g10590 Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin. No verified direct reference in this release
At4g10570 Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin. No verified direct reference in this release
At1g32850 Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin. No verified direct reference in this release
At5g22030 Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_019075 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006508 proteolysis Biological Process
GO:0006511 ubiquitin-dependent protein catabolic process Biological Process
GO:0007032 endosome organization Biological Process
GO:0007265 Ras protein signal transduction Biological Process
GO:0016579 protein deubiquitination Biological Process
GO:0141137 positive regulation of gene expression, epigenetic Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0004843 cysteine-type deubiquitinase activity Molecular Function
GO:0140950 histone H2A deubiquitinase activity Molecular Function
KEGG gene cross-reference
ath:AT1G32850
ath:AT2G40930
ath:AT4G10570
ath:AT4G10590
ath:AT5G22030
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.548
Rank 1 · TkA04G029410 · TK1151
Cytoplasm0.541
Rank 2 · TkA04G029410 · TK1151
Mitochondrion0.060
Rank 3 · TkA04G029410 · TK1151
Cell membrane0.052
Rank 4 · TkA04G029410 · TK1151
Endoplasmic reticulum0.042
Rank 5 · TkA04G029410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06337DUSP37-128 aa
PF08274Zn_Ribbon_YjdM84-93 aa
PF07600DUF156498-113 aa
PF25242Ubiquitin_UBP8149-195 aa
PF24643DUF7637149-211 aa
PF14836Ubiquitin_3160-226 aa
PF24541Thioredox_PDIA6_C210-230 aa
PF00443UCH274-635 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G029410PF06337DUSP371282.9e-2176.4
TkA04G029410PF08274Zn_Ribbon_YjdM84931.69.5
TkA04G029410PF07600DUF1564981130.113.0
TkA04G029410PF25242Ubiquitin_UBP81491955.8e-0729.8
TkA04G029410PF24643DUF76371492110.1113.3
TkA04G029410PF14836Ubiquitin_31602260.004517.6
TkA04G029410PF24541Thioredox_PDIA6_C2102300.3112.0
TkA04G029410PF00443UCH2746352.2e-75254.3
TkA04G029410PF13423UCH_12756171.3e-1868.4
TkA04G029410PF08274Zn_Ribbon_YjdM4324391.69.5
TkA04G029410PF07600DUF15644945200.113.0
TkA04G029410PF08274Zn_Ribbon_YjdM5025101.69.5
TkA04G029410PF24541Thioredox_PDIA6_C5135490.3112.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O22207Arabidopsis thalianasp|O22207|UBP5_ARATH Ubiquitin carboxyl-terminal hydrolase 543.700%Swiss-ProtMedium
Q93Y01Arabidopsis thalianasp|Q93Y01|UBP9_ARATH Ubiquitin carboxyl-terminal hydrolase 934.800%Swiss-ProtMedium
Q9ZSB5Arabidopsis thalianasp|Q9ZSB5|UBP10_ARATH Ubiquitin carboxyl-terminal hydrolase 1034.600%Swiss-ProtMedium
Q9MAQ3Arabidopsis thalianasp|Q9MAQ3|UBP11_ARATH Putative ubiquitin carboxyl-terminal hydrolase 1134.300%Swiss-ProtMedium
Q9C585Arabidopsis thalianasp|Q9C585|UBP8_ARATH Ubiquitin carboxyl-terminal hydrolase 833.000%Swiss-ProtMedium

JBrowse

View in Genome Browser