RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G024810
Reference: TK1151 Chr: Chr04 Coordinates: 6449147-6452233 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1803 bp · TkA04G024810|TK1151|cDNA

TTCCTCTCTCTATCTCACTTCTTACCCAACTTAATCCTACATAATCTCCTTTATTCTTATTCACTCTTCTTCCTAGAATCTTTTCTCCACATTTCTCCCATGGAACAACTCCAACACCACCCACAGCTCACGTTAGCCAAGAGCTCTCGTCACCACTATAATGAATGGATATTTCGCGATGTCCCCAGTGATATAACAATAGAAGTGAACGGTGTCACGTTTGCATTACATAAGTTTCCTCTCGTATCCCGTAGCGGACA...

CDS

Download CDS FASTA

1905 bp · TkA04G024810|TK1151|CDS

TTCCTCTCTCTATCTCACTTCTTACCCAACTTAATCCTACATAATCTCCTTTATTCTTATTCACTCTTCTTCCTAGAATCTTTTCTCCACATTTCTCCCATGGAACAACTCCAACACCACCCACAGCTCACGTTAGCCAAGAGCTCTCGTCACCACTATAATGAATGGATATTTCGCGATGTCCCCAGTGATATAACAATAGAAGTGAACGGTGTCACGTTTGCATTACATAAGTTTCCTCTCGTATCCCGTAGCGGACA...

Protein

Download Protein FASTA

634 aa · TkA04G024810|TK1151|PROTEIN

FLSLSHFLPNLILHNLLYSYSLFFLESFLHISPMEQLQHHPQLTLAKSSRHHYNEWIFRDVPSDITIEVNGVTFALHKFPLVSRSGQIRKTVSENRDSVISRITLQNLPGGTEAFELAAKFCYGVNFEITPSNVAQLICVSDYLEMTDDFSNNNLGLRADEYLNNVVCQNLEMSVLVLQQCENLLPKADELKIVTRCIDAIASKACVEQIASSFSRLEYSSSGRLHMSRTKCELDWWIKDLSVLRIDLYQRVMSAMKCRG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G024810
TK1151 IDTkA04G024810
OH-1004 IDLXL04_036778
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.800
Protein coverage (%)TK1151 94.322 / OH-1004 99.007
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G024810
LocationChr04:6449147-6452233 (+)
DescriptionSimilar to At5g48800: BTB/POZ domain-containing protein At5g48800
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g48800 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At1g03010 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At2g47860 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At3g08570 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At3g08660 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036778 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009846 pollen germination Biological Process
GO:0009860 pollen tube growth Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0005634 nucleus Cellular Component
GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference
ath:AT1G03010
ath:AT2G47860
ath:AT3G08570
ath:AT3G08660
ath:AT5G48800
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.515
Rank 1 · TkA04G024810 · TK1151
Cytoplasm0.375
Rank 2 · TkA04G024810 · TK1151
Cell membrane0.159
Rank 3 · TkA04G024810 · TK1151
Endoplasmic reticulum0.050
Rank 4 · TkA04G024810 · TK1151
Lysosome / Vacuole0.047
Rank 5 · TkA04G024810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16406DUF501433-82 aa
PF00651BTB63-148 aa
PF20331DUF6626144-189 aa
PF26052BRE1B224-251 aa
PF03000NPH3235-484 aa
PF26052BRE1B495-512 aa
PF14988DUF4515540-586 aa
PF05557MAD545-584 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G024810PF16406DUF501433820.1612.8
TkA04G024810PF00651BTB631483.9e-0627.7
TkA04G024810PF20331DUF66261441890.06714.3
TkA04G024810PF26052BRE1B2242516.37.3
TkA04G024810PF03000NPH32354841.5e-91307.3
TkA04G024810PF26052BRE1B4955126.37.3
TkA04G024810PF14988DUF45155405860.1113.2
TkA04G024810PF05557MAD5455840.06212.4
TkA04G024810PF06156YabA5465910.06914.5
TkA04G024810PF02183HALZ5475700.09213.6
TkA04G024810PF17078SHE35475940.3711.2
TkA04G024810PF26022CC_Liprin_beta5506010.2612.3
TkA04G024810PF26052BRE1B5505896.37.3
TkA04G024810PF29075NOCA1_mid5515900.03414.7
TkA04G024810PF25068ARM_TT21_4th5546020.1812.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FKB6Arabidopsis thalianasp|Q9FKB6|Y5880_ARATH BTB/POZ domain-containing protein At5g4880073.400%Swiss-ProtHigh
Q9SA69Arabidopsis thalianasp|Q9SA69|Y1301_ARATH BTB/POZ domain-containing protein At1g0301047.000%Swiss-ProtMedium
O82253Arabidopsis thalianasp|O82253|SETH6_ARATH BTB/POZ domain-containing protein SETH647.200%Swiss-ProtMedium
Q9C9Z7Arabidopsis thalianasp|Q9C9Z7|Y3857_ARATH BTB/POZ domain-containing protein At3g0857048.400%Swiss-ProtMedium
Q9C9Z0Arabidopsis thalianasp|Q9C9Z0|Y3866_ARATH Putative BTB/POZ domain-containing protein At3g0866047.300%Swiss-ProtMedium

JBrowse

View in Genome Browser