TkA04G020730 | RubberDandelionOmics

Gene overview

TkA04G020730

Reference: TK1151 Chr: Chr04 Coordinates: 5277013-5284234 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1643 bp · TkA04G020730|TK1151|cDNA

TACAATGTAATTGTAACCTAGTGTTTATTATCAAAGTCCATAAATGATTTTTGAAACTCAATTCCAAACACCTTCTTATTCTATACGAATAATATAACAGAGGTAAATAAGGGCTTGTTTTGTTTGGATTCCGATTTCCGTTGTTCAGTTCGATCTACTCTAAATAACTGTTTGTTCTCCGTAGTGGATCTCGGTGAAAACGATCAACATAAAAATGGTGAGAGGATTATTCAACAAGCTCGCATCTAAATCGCTGAATG...

CDS

Download CDS FASTA

2100 bp · TkA04G020730|TK1151|CDS

ATGGACAAAGATACGACGCATCCTTATCTCAGTTTATTTGCTGCATTATCATATGGAATTGCATCAATGGCGATGGTTTTCATAAACAAAGCAGTCGTCATGGAGTATGCATACTCCATGACTCTCCTTACCTTACAGCAATTGGCAACTGCATTACTTATACATTTTGGAAGAATAATGGGATTCACAAGAGCCAAACCACTAAATGTTGACACTGCTAAAAAACTTATACTCGTTTCACTATTTTACAATGGTAATGT...

Protein

Download Protein FASTA

699 aa · TkA04G020730|TK1151|PROTEIN

MDKDTTHPYLSLFAALSYGIASMAMVFINKAVVMEYAYSMTLLTLQQLATALLIHFGRIMGFTRAKPLNVDTAKKLILVSLFYNGNVAFALASLKGVNIPMYIAIKRLTPLAVLIAGLFYKKGKHSKQVIFSVSLTAAGVMIAALGDFSFDLFGYIMALISVFFQTMYLVLVERSGAEDGLSSIEIMFYNSLLSLPFLVFLIIVTSEFPNSISLLYAKSASLYFLVMFVLSLMMGIILNYTMFLCTIVNSALTTTIVGVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G020730`
TK1151 ID	TkA04G020730
OH-1004 ID	LXL04_036848
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G020730

Location Chr04:5277013-5284234 (-)

Description Similar to At2g20420: Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20420`	Succinyl-CoA synthetase functions in the citric acid cycle (TCA), coupling the hydrolysis of succinyl-CoA to the synthesis of ATP and thus represents the only step of substrate-level phosphorylation in the TCA.	No verified direct reference in this release
`At4g31600`	Nucleotide-sugar transporter that transports UDP-glucose and UDP-galactose.	Arabidopsis thaliana AtUTr7 encodes a golgi-localized UDP-glucose/UDP-galactose transporter that affects lateral root emergence.2012 · DOI: 10.1093/mp/sss074
`At4g32272`	Mediates the transport of UDP-N-acetylglucosamine (UDP- GlcNAc) across the Golgi apparatus membrane.	A Golgi UDP-GlcNAc transporter delivers substrates for N-linked glycans and sphingolipids.2018 · DOI: 10.1038/s41477-018-0235-5

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0621700`	Succinyl-CoA synthetase functions in the citric acid cycle (TCA), coupling the hydrolysis of succinyl-CoA to the synthesis of ATP and thus represents the only step of substrate-level phosphorylation in the TCA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036848 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006104 succinyl-CoA metabolic process Biological Process

GO:0006105 succinate metabolic process Biological Process

GO:0015786 UDP-glucose transmembrane transport Biological Process

GO:0048527 lateral root development Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0072334 UDP-galactose transmembrane transport Biological Process

GO:0080147 root hair cell development Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G20420

ath:AT4G31600

ddi:DDB_G0271842

dosa:Os02g0621700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.613

Rank 1 · TkA04G020730 · TK1151

Cytoplasm0.109

Rank 2 · TkA04G020730 · TK1151

Mitochondrion0.092

Rank 3 · TkA04G020730 · TK1151

Golgi apparatus0.087

Rank 4 · TkA04G020730 · TK1151

Plastid0.065

Rank 5 · TkA04G020730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03151TPT20-270 aa

PF08449UAA27-257 aa

PF13549ATP-grasp_5303-527 aa

PF08442ATP-grasp_2305-513 aa

PF24948Citrate_synth_N323-538 aa

PF21244PurT_C325-340 aa

PF04472SepF464-494 aa

PF13607Succ_CoA_lig568-684 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G020730	`PF03151`	TPT	20	270	1.5e-09	38.4
TkA04G020730	`PF08449`	UAA	27	257	9.5e-09	35.5
TkA04G020730	`PF13549`	ATP-grasp_5	303	527	0.014	15.5
TkA04G020730	`PF08442`	ATP-grasp_2	305	513	3.3e-59	200.6
TkA04G020730	`PF24948`	Citrate_synth_N	323	538	3.6e-12	46.9
TkA04G020730	`PF21244`	PurT_C	325	340	0.58	10.4
TkA04G020730	`PF04472`	SepF	464	494	0.13	13.2
TkA04G020730	`PF13607`	Succ_CoA_lig	568	684	0.022	15.2
TkA04G020730	`PF00549`	Ligase_CoA	573	693	5.8e-36	124.2
TkA04G020730	`PF04472`	SepF	646	674	0.13	13.2
TkA04G020730	`PF21244`	PurT_C	651	697	0.58	10.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82662`	Arabidopsis thaliana	sp\|O82662\|SUCB_ARATH Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial	87.600%	Swiss-Prot	High
`Q94B65`	Arabidopsis thaliana	sp\|Q94B65\|UTR7_ARATH UDP-galactose/UDP-glucose transporter 7	78.200%	Swiss-Prot	High
`A8MRY9`	Arabidopsis thaliana	sp\|A8MRY9\|UGNT1_ARATH UDP-N-acetylglucosamine transporter UGNT1	28.800%	Swiss-Prot	Low
`Q6K9N6`	Oryza sativa subsp. japonica	sp\|Q6K9N6\|SUCB_ORYSJ Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial	86.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card