LXL04_036848 | RubberDandelionOmics

Gene overview

LXL04_036848

Reference: OH-1004 Chr: Chr08 Coordinates: 49135527-49142230 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2226 bp · LXL04_036848|LXL04_036848|OH1004|cDNA

ATGGACAAAGATACGACGCATCCTTATCTCAGTTTATTTGCTGCATTATCATATGGAATTGCATCAATGGCGATGGTTTTCATAAACAAAGCAGTCGTCATGGAGTATGCATACTCCATGACTCTCCTTACCTTACAGCAATTGGCAACTGcattacttatacattttggAAGAATAATGGGATTCACAAGAGCCAAACCACTAAATGTTGACACTGCTAAAAAACTTATACTCGTTTCACTATTTTACAATGGTAATGT...

CDS

Download CDS FASTA

2226 bp · LXL04_036848|LXL04_036848|OH1004|CDS

ATGGACAAAGATACGACGCATCCTTATCTCAGTTTATTTGCTGCATTATCATATGGAATTGCATCAATGGCGATGGTTTTCATAAACAAAGCAGTCGTCATGGAGTATGCATACTCCATGACTCTCCTTACCTTACAGCAATTGGCAACTGCATTACTTATACATTTTGGAAGAATAATGGGATTCACAAGAGCCAAACCACTAAATGTTGACACTGCTAAAAAACTTATACTCGTTTCACTATTTTACAATGGTAATGT...

Protein

Download Protein FASTA

741 aa · LXL04_036848|LXL04_036848|OH1004|PROTEIN

MDKDTTHPYLSLFAALSYGIASMAMVFINKAVVMEYAYSMTLLTLQQLATALLIHFGRIMGFTRAKPLNVDTAKKLILVSLFYNGNVAFALASLKGVNIPMYIAIKRLTPLAVLIAGLFYKKGKHSKQVIFSVSLTAAGVMIAALGDFSFDLFGYIMALISVFFQTMYLVLVERSGAEEGLSSIEIMFYNSLLSLPFLVFLIIVTSEFPNSISLLYAKSASLYFLVMFVLSLMMGIILNYTMFLCTIVNSALTTTIVGVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036848`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036848

Location Chr08:49135527-49142230 (+)

Description Similar to At2g20420: Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20420`	Succinyl-CoA synthetase functions in the citric acid cycle (TCA), coupling the hydrolysis of succinyl-CoA to the synthesis of ATP and thus represents the only step of substrate-level phosphorylation in the TCA.	No verified direct reference in this release
`At4g31600`	Nucleotide-sugar transporter that transports UDP-glucose and UDP-galactose.	Arabidopsis thaliana AtUTr7 encodes a golgi-localized UDP-glucose/UDP-galactose transporter that affects lateral root emergence.2012 · DOI: 10.1093/mp/sss074

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0621700`	Succinyl-CoA synthetase functions in the citric acid cycle (TCA), coupling the hydrolysis of succinyl-CoA to the synthesis of ATP and thus represents the only step of substrate-level phosphorylation in the TCA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036848 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006104 succinyl-CoA metabolic process Biological Process

GO:0006105 succinate metabolic process Biological Process

GO:0015786 UDP-glucose transmembrane transport Biological Process

GO:0048527 lateral root development Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0072334 UDP-galactose transmembrane transport Biological Process

GO:0080147 root hair cell development Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G20420

ath:AT4G31600

ddi:DDB_G0271842

dosa:Os02g0621700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.576

Rank 1 · LXL04_036848 · OH-1004

Mitochondrion0.111

Rank 2 · LXL04_036848 · OH-1004

Cytoplasm0.107

Rank 3 · LXL04_036848 · OH-1004

Golgi apparatus0.077

Rank 4 · LXL04_036848 · OH-1004

Peroxisome0.072

Rank 5 · LXL04_036848 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03151.23TPT20-297 aa

PF08449.18UAA27-257 aa

PF08442.16ATP-grasp_2347-555 aa

PF24948.2Citrate_synth_N366-580 aa

PF00549.25Ligase_CoA615-735 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036848	`PF03151.23`	TPT	20	297	1.6e-10	41.6
LXL04_036848	`PF08449.18`	UAA	27	257	7e-09	36.0
LXL04_036848	`PF08442.16`	ATP-grasp_2	347	555	3.3e-59	200.6
LXL04_036848	`PF24948.2`	Citrate_synth_N	366	580	6.8e-12	46.0
LXL04_036848	`PF00549.25`	Ligase_CoA	615	735	6.3e-36	124.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82662`	Arabidopsis thaliana	Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial	87.351%	Swiss-Prot	moderate database homology
`Q94B65`	Arabidopsis thaliana	UDP-galactose/UDP-glucose transporter 7	77.852%	Swiss-Prot	weak database homology
`Q6K9N6`	Oryza sativa subsp. japonica	Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrial	86.396%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card