TkA04G014850 | RubberDandelionOmics

Gene overview

TkA04G014850

Reference: TK1151 Chr: Chr04 Coordinates: 3721836-3728543 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3581 bp · TkA04G014850|TK1151|cDNA

ACAGAAGCAGTAGGAGGTGGGTGTACAGAGAGATAGGAGCGAGAGTGGTGTGATAGTGGCGAGAGACGATACACATTAGCGAGTACTGTTCGTTGACATAACCTAAAAGGTCAACAATTAGTATATATAGTTAATGCTATCGGTAAAAAGGTGGTCAATTTCGGGGTCAAAAACCCCAGAACATAACCCTTGTCGGTTTAACCGTTAATTCGAACCAGCTCTTCTAAACTATGACTTCCGACTACCGGCGCAGTTCCTCC...

CDS

Download CDS FASTA

3027 bp · TkA04G014850|TK1151|CDS

ATGAATAGGAAAATATTCATTTTGTCAGTGTTAGGGTTTGTTATCTGGACCATTCCACGTACCGCCGGCGAATCGTCGACGTGCTTGGAGGTGTATAAAGAAGGCGGTGCGCCGGCTGTGTTCCAATCACCAAAATGCCCTCGCTGGAGCTTACCAAAACACGATCGTCGGATACAATCCACAGCTGGAAGATGTCAATCGGCTACACGGCAGGGCCGACGAAAGTCTCTCGAAGATCGCACTTTCTGTACTATGGACAT...

Protein

Download Protein FASTA

1008 aa · TkA04G014850|TK1151|PROTEIN

MNRKIFILSVLGFVIWTIPRTAGESSTCLEVYKEGGAPAVFQSPKCPRWSLPKHDRRIQSTAGRCQSATRQGRRKSLEDRTFCTMDIRIPFPDFNGIRDTSVGIVAVFDGHNGAEASEMASKLLLEYFILHTYFLLDNAFSFLSMTSKGMLPNKGEDDYASQMLSWDEKLGEHVLHIGRIKFTLSTIFDRAFHLEILKESLLKAINDIDAAFCKEASRYNLNSGSTAAVILIADSQILAANVGDSKAFLCSEMFQPPTEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G014850`
TK1151 ID	TkA04G014850
OH-1004 ID	LXL04_036943
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G014850

Location Chr04:3721836-3728543 (-)

Description Similar to At3g63330: Probable inactive protein kinase At3g63330

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63330`	Probable inactive protein kinase At3g63330.	No verified direct reference in this release
`At3g63340`	Probable protein phosphatase 2C 51.	No verified direct reference in this release
`At3g63320`	Putative protein phosphatase 2C 50.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0586001`	Putative protein phosphatase 2C 76.	No verified direct reference in this release
`Os03g0292100`	Probable protein phosphatase 2C 32.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036943 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0044773 mitotic DNA damage checkpoint signaling Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G63320

ath:AT3G63340

hsa:80895

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.320

Rank 1 · TkA04G014850 · TK1151

Golgi apparatus0.203

Rank 2 · TkA04G014850 · TK1151

Cell membrane0.186

Rank 3 · TkA04G014850 · TK1151

Cytoplasm0.182

Rank 4 · TkA04G014850 · TK1151

Lysosome / Vacuole0.163

Rank 5 · TkA04G014850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C67-127 aa

PF13672PP2C_2104-250 aa

PF00481PP2C200-251 aa

PF00481PP2C300-430 aa

PF07714PK_Tyr_Ser-Thr595-623 aa

PF07714PK_Tyr_Ser-Thr674-891 aa

PF00069Pkinase757-1002 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G014850	`PF00481`	PP2C	67	127	2.2e-39	136.4
TkA04G014850	`PF13672`	PP2C_2	104	250	0.18	12.1
TkA04G014850	`PF00481`	PP2C	200	251	2.2e-39	136.4
TkA04G014850	`PF00481`	PP2C	300	430	2.2e-39	136.4
TkA04G014850	`PF07714`	PK_Tyr_Ser-Thr	595	623	1.3e-07	31.9
TkA04G014850	`PF07714`	PK_Tyr_Ser-Thr	674	891	1.3e-07	31.9
TkA04G014850	`PF00069`	Pkinase	757	1002	2.7e-26	93.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXY0`	Arabidopsis thaliana	sp\|Q8RXY0\|Y3333_ARATH Probable inactive protein kinase At3g63330	63.700%	Swiss-Prot	Low
`Q93YS2`	Arabidopsis thaliana	sp\|Q93YS2\|P2C51_ARATH Probable protein phosphatase 2C 51	54.000%	Swiss-Prot	Low
`Q9M1V8`	Arabidopsis thaliana	sp\|Q9M1V8\|P2C50_ARATH Putative protein phosphatase 2C 50	55.000%	Swiss-Prot	Low
`A3CCP9`	Oryza sativa subsp. japonica	sp\|A3CCP9\|P2C76_ORYSJ Putative protein phosphatase 2C 76	49.100%	Swiss-Prot	Low
`Q10MX1`	Oryza sativa subsp. japonica	sp\|Q10MX1\|P2C32_ORYSJ Probable protein phosphatase 2C 32	36.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card