LXL04_036943 | RubberDandelionOmics

Gene overview

LXL04_036943

Reference: OH-1004 Chr: Chr08 Coordinates: 50672317-50678461 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3033 bp · LXL04_036943|LXL04_036943|OH1004|cDNA

ATGAATAGGAAAATATTCATTTTGTCAGTGTTAGGGTTTGTTATCTGGACCATTCCACGTACCGCCGGCGAATCGTCGACGTGCTTGGAGGTGTATAAAGAAGGCGGTGCGCCGGCGGTGTTCCAATCACCAAAATGCCCTCGCTGGAGCTTACCAAAACACGATCGTCGGATACAATCCACAGCTGGAAGATGTCAATCGGCTACACGGCAGGGCCGACGAAAGTCTCTCGAAGATCGCACTTTCTGTACTATGGACAT...

CDS

Download CDS FASTA

3033 bp · LXL04_036943|LXL04_036943|OH1004|CDS

ATGAATAGGAAAATATTCATTTTGTCAGTGTTAGGGTTTGTTATCTGGACCATTCCACGTACCGCCGGCGAATCGTCGACGTGCTTGGAGGTGTATAAAGAAGGCGGTGCGCCGGCGGTGTTCCAATCACCAAAATGCCCTCGCTGGAGCTTACCAAAACACGATCGTCGGATACAATCCACAGCTGGAAGATGTCAATCGGCTACACGGCAGGGCCGACGAAAGTCTCTCGAAGATCGCACTTTCTGTACTATGGACAT...

Protein

Download Protein FASTA

1010 aa · LXL04_036943|LXL04_036943|OH1004|PROTEIN

MNRKIFILSVLGFVIWTIPRTAGESSTCLEVYKEGGAPAVFQSPKCPRWSLPKHDRRIQSTAGRCQSATRQGRRKSLEDRTFCTMDIRIPFPDFNGIRDTSVGIVAVFDGHNGAEASEMASKLLLEYFILHTYFLLDNAFSFLSMTSKGMLPNKGEDDYASQMLSWDEKLGEHVLHIGRIKFTLSTIFDRAFHLEILKESLLKAINDIDAAFCKEASRYNLNSGSTAAVILIADSQILAANVGDSKAFLCSEMFQPPTEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036943`
TK1151 ID	TkA04G014850
OH-1004 ID	LXL04_036943
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036943

Location Chr08:50672317-50678461 (+)

Description Similar to At3g63330: Probable inactive protein kinase At3g63330

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63330`	Probable inactive protein kinase At3g63330.	No verified direct reference in this release
`At3g63340`	Probable protein phosphatase 2C 51.	No verified direct reference in this release
`At3g63320`	Putative protein phosphatase 2C 50.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0586001`	Putative protein phosphatase 2C 76.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036943 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0044773 mitotic DNA damage checkpoint signaling Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G63320

ath:AT3G63340

hsa:80895

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.325

Rank 1 · LXL04_036943 · OH-1004

Golgi apparatus0.199

Rank 2 · LXL04_036943 · OH-1004

Cytoplasm0.196

Rank 3 · LXL04_036943 · OH-1004

Cell membrane0.180

Rank 4 · LXL04_036943 · OH-1004

Nucleus0.163

Rank 5 · LXL04_036943 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C200-251 aa

PF00481.27PP2C300-430 aa

PF07714.24PK_Tyr_Ser-Thr674-893 aa

PF00069.32Pkinase760-1004 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036943	`PF00481.27`	PP2C	200	251	2.3e-39	136.3
LXL04_036943	`PF00481.27`	PP2C	300	430	2.3e-39	136.3
LXL04_036943	`PF07714.24`	PK_Tyr_Ser-Thr	674	893	2.2e-07	31.2
LXL04_036943	`PF00069.32`	Pkinase	760	1004	5e-26	92.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXY0`	Arabidopsis thaliana	Probable inactive protein kinase At3g63330	63.130%	Swiss-Prot	weak database homology
`Q93YS2`	Arabidopsis thaliana	Probable protein phosphatase 2C 51	55.924%	Swiss-Prot	weak database homology
`Q9M1V8`	Arabidopsis thaliana	Putative protein phosphatase 2C 50	54.701%	Swiss-Prot	weak database homology
`A3CCP9`	Oryza sativa subsp. japonica	Putative protein phosphatase 2C 76	50.439%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card