TkA04G014510 | RubberDandelionOmics

Gene overview

TkA04G014510

Reference: TK1151 Chr: Chr04 Coordinates: 3635669-3637954 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1066 bp · TkA04G014510|TK1151|cDNA

TTCTCTGAATTTTATACTTATTTTTACAGGCAACAATTCAAGGGTTTGAAGCCAAAGGCTTCACTAAACAGGAAGGTGAAGCCATGCTTAAAAAGAGTGTAGATATTGCACGTGAAGCAAGAGATATATATAATAAAAAATGTGGTGAATCTTCTAGACCTATTTTAGTTGCTGCATCTGTTGGAAGCTATGGTGCATATTTGGCTGATGGTTCTGAATACAGTGGGGACTATGGCAATGCAATGAATCTTGAATTCTTA...

CDS

Download CDS FASTA

546 bp · TkA04G014510|TK1151|CDS

ATGCTTAAAAAGAGTGTAGATATTGCACGTGAAGCAAGAGATATATATAATAAAAAATGTGGTGAATCTTCTAGACCTATTTTAGTTGCTGCATCTGTTGGAAGCTATGGTGCATATTTGGCTGATGGTTCTGAATACAGTGGGGACTATGGCAATGCAATGAATCTTGAATTCTTAAAAAGTTTTCACAGGAGAAGAGTTCAAGTTTTAGCTGAATCTTGTCCTGACTTAATAGCTTTTGAAACAATACCAAATAAGCT...

Protein

Download Protein FASTA

181 aa · TkA04G014510|TK1151|PROTEIN

MLKKSVDIAREARDIYNKKCGESSRPILVAASVGSYGAYLADGSEYSGDYGNAMNLEFLKSFHRRRVQVLAESCPDLIAFETIPNKLEAKAFAELLEEGIKIPAWFSFNSKDGVNVVSGDSLTECAKIADSCKKVVAVGINCTPPRFISGLILAIKKATSKPILIYPNSGETYMMLKLSSG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G014510`
TK1151 ID	TkA04G014510
OH-1004 ID	LXL04_036949
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 95.580 / OH-1004 52.424 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G014510

Location Chr04:3635669-3637954 (-)

Description Similar to HMT-2: Homocysteine S-methyltransferase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63250`	Catalyzes methyl transfer from S-methylmethionine (SMM) to adenosyl-L-homocysteine (AdoMet).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036949 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009086 methionine biosynthetic process Biological Process

GO:0010269 response to selenium ion Biological Process

GO:0032259 methylation Biological Process

GO:0033528 S-methylmethionine cycle Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0008898 S-adenosylmethionine-homocysteine S-methyltransferase activity Molecular Function

GO:0016205 selenocysteine methyltransferase activity Molecular Function

GO:0061627 S-methylmethionine-homocysteine S-methyltransferase activity Molecular Function

KEGG gene cross-reference

ag:AAX20123

ag:CAA10368

ath:AT3G63250

zma:541874

zma:541875

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.625

Rank 1 · TkA04G014510 · TK1151

Nucleus0.318

Rank 2 · TkA04G014510 · TK1151

Mitochondrion0.088

Rank 3 · TkA04G014510 · TK1151

Cell membrane0.079

Rank 4 · TkA04G014510 · TK1151

Endoplasmic reticulum0.064

Rank 5 · TkA04G014510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02574S-methyl_trans1-173 aa

PF29910HssS_N3-66 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G014510	`PF02574`	S-methyl_trans	1	173	3.2e-38	133.0
TkA04G014510	`PF29910`	HssS_N	3	66	0.36	11.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1W4`	Arabidopsis thaliana	sp\|Q9M1W4\|HMT2_ARATH Homocysteine S-methyltransferase 2	74.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card