TkA04G013240 | RubberDandelionOmics

Gene overview

TkA04G013240

Reference: TK1151 Chr: Chr04 Coordinates: 3285557-3292272 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3120 bp · TkA04G013240|TK1151|cDNA

ATATATATAGGAGAGTGGTTTCCATCCAATAACCTATAAAAATATACTATTCTGAAAGCCTATAAATCCGTTACCTTCAGGTGACACTTCGTCTTTGTAAAAAGCCGAGTTTATAAACAAGAAACCCGATAATACAAGCATCATGAAAACGATGATCTCGTCGCCGATCATAAACTTCCACCCCCAGTCTTCTCTGGCCTCGGGTTATCATCGTCTTTCTCCCCTCCTTCCATCACCAACTGGAACTGTAGTCCTTAAAG...

CDS

Download CDS FASTA

1827 bp · TkA04G013240|TK1151|CDS

ATGAAAACGATGATCTCGTCGCCGATCATAAACTTCCACCCCCAGTCTTCTCTGGCCTCGGGTTATCATCGTCTTTCTCCCCTCCTTCCATCACCAACTGGAACTGTAGTCCTTAAAGGATCCAATTTTCAATGTAAGGCCGTATCAAAATCTCCTACACAAGAATACCTTGATGTACTTCAAAAAAATGGTTTGCCATTTATAAACTGGCAAAATGACATCGTGGAGGATGACGTGGCTACAGATAAGATTTTGTACCC...

Protein

Download Protein FASTA

608 aa · TkA04G013240|TK1151|PROTEIN

MKTMISSPIINFHPQSSLASGYHRLSPLLPSPTGTVVLKGSNFQCKAVSKSPTQEYLDVLQKNGLPFINWQNDIVEDDVATDKILYPSDEIKGFVERIRAMLGSMDEGEITVSAYDTAWVALVQDVNGTGRPQFPSSLEWIMNNQLPDGSWGDRLIFSAHDRIINTLACVIALTSWNVHPNKCKKGLKFLNENISKLEEENPEHMPIGFEVAFPSLIDIARKLDIEVPEDSPALKEIYARRNLKLTKIPKNLMHKVPTTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G013240`
TK1151 ID	TkA04G013240
OH-1004 ID	LXL04_036969
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.300
Protein coverage (%)	TK1151 99.178 / OH-1004 75.093 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G013240`
Location	Chr04:3285557-3292272 (+)
Description	Similar to TPS28: (-)-kolavenyl diphosphate synthase TPS28, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036969` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009686 gibberellin biosynthetic process Biological Process GO:0016102 diterpenoid biosynthetic process Biological Process GO:0009507 chloroplast Cellular Component GO:0000287 magnesium ion binding Molecular Function GO:0009905 ent-copalyl diphosphate synthase activity Molecular Function GO:0010333 terpene synthase activity Molecular Function GO:0016853 isomerase activity Molecular Function GO:0102161 copal-8-ol diphosphate synthase activity Molecular Function
KEGG gene cross-reference	ag:ANO43021 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.958

Rank 1 · TkA04G013240 · TK1151

Cytoplasm0.062

Rank 2 · TkA04G013240 · TK1151

Mitochondrion0.051

Rank 3 · TkA04G013240 · TK1151

Peroxisome0.051

Rank 4 · TkA04G013240 · TK1151

Nucleus0.022

Rank 5 · TkA04G013240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03936Terpene_synth_C192-224 aa

PF01397Terpene_synth271-477 aa

PF08730Rad33336-366 aa

PF08730Rad33537-569 aa

PF03936Terpene_synth_C563-606 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G013240	`PF03936`	Terpene_synth_C	192	224	4e-05	23.8
TkA04G013240	`PF01397`	Terpene_synth	271	477	2.3e-49	168.4
TkA04G013240	`PF08730`	Rad33	336	366	0.095	13.4
TkA04G013240	`PF08730`	Rad33	537	569	0.095	13.4
TkA04G013240	`PF03936`	Terpene_synth_C	563	606	4e-05	23.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card