TkA04G000680 | RubberDandelionOmics

Gene overview

TkA04G000680

Reference: TK1151 Chr: Chr04 Coordinates: 164329-170236 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3670 bp · TkA04G000680|TK1151|cDNA

TTTATCCTGTGTTTTGCTTGTGCGTACGAAAGAAAAGGACACACCAAAAGATAAGGGCATTCCGCACACATACTCAAAAATTTATTTTGTAATTTCCCGGATTATCTCGTTGCTGTTTTGCCGTATCCAGATCGACACCTTATCCGAACCAGTTTGATTTGCTAGTCTCGTCCAGTTTTCCCCACTCATTTTCTTCGTCTTCTTCCTTAGTTCTATAACTGGAGAAGGGGTTCTTACCTTCGAAGTTATGGGGAAGCCAG...

CDS

Download CDS FASTA

1842 bp · TkA04G000680|TK1151|CDS

ATGCAGGGTAGGCGTTGGAGTGATGGGCTTCACCAGGCGGTGGAAGCCAAAGAAAGCTTGCCCATACAAAATGAGACCGTGACCCTCGCCTCAATTAGCTACCAAAACTTCTTTCTTCAGTTTCCAAAACTTTGTGGCATGACCGGCACCGCTGCAACCGAGAGTTCAGAGTTTGAAAGTATTTACAAGCTCAAAGTCACAATCGTGCCCACAAACAAGCCTATGATACGAAAGGATGAGTCGGACGTGGTGTTTAGGGC...

Protein

Download Protein FASTA

613 aa · TkA04G000680|TK1151|PROTEIN

MQGRRWSDGLHQAVEAKESLPIQNETVTLASISYQNFFLQFPKLCGMTGTAATESSEFESIYKLKVTIVPTNKPMIRKDESDVVFRATTGKWQAVVVEVSRMNKTGRPVLVGTTSVEQSDTLSKQLREAGIPHEVLNAKPENVEREAEIVAQSGRLGAVTIATNMAGRGTDIILGGNAEFMARLKLRELLMPSVVKPAEGVFVSVKKAPPNKTWKVSESLFPCPLSQENSLVVEEAVHLAVSSWGRRSLAELEAEERLSY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G000680`
TK1151 ID	TkA04G000680
OH-1004 ID	LXL04_037138
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 58.049 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G000680

Location Chr04:164329-170236 (-)

Description Similar to SECA1: Protein translocase subunit SECA1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01800`	Has a central role in coupling the hydrolysis of ATP to the transfer of proteins across the thylakoid membrane.	Plastids contain a second sec translocase system with essential functions.2011 · DOI: 10.1104/pp.110.166546

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037138 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006605 protein targeting Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010109 regulation of photosynthesis Biological Process

GO:0017038 protein import Biological Process

GO:0065002 intracellular protein transmembrane transport Biological Process

GO:0071806 protein transmembrane transport Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ag:CAA57798

ath:AT4G01800

olu:OSTLU_36933

tel:tll1851

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.532

Rank 1 · TkA04G000680 · TK1151

Cytoplasm0.242

Rank 2 · TkA04G000680 · TK1151

Nucleus0.144

Rank 3 · TkA04G000680 · TK1151

Plastid0.114

Rank 4 · TkA04G000680 · TK1151

Peroxisome0.065

Rank 5 · TkA04G000680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01043SecA_PP_bind1-15 aa

PF07517SecA_DEAD9-59 aa

PF21090P-loop_SecA74-363 aa

PF00271Helicase_C95-172 aa

PF07516SecA_SW268-298 aa

PF00271Helicase_C304-328 aa

PF30778SBP_bac_4HB361-430 aa

PF07516SecA_SW365-580 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G000680	`PF01043`	SecA_PP_bind	1	15	0.0022	19.3
TkA04G000680	`PF07517`	SecA_DEAD	9	59	4.8e-15	56.3
TkA04G000680	`PF21090`	P-loop_SecA	74	363	3.2e-84	282.4
TkA04G000680	`PF00271`	Helicase_C	95	172	0.0029	18.5
TkA04G000680	`PF07516`	SecA_SW	268	298	9.5e-56	189.7
TkA04G000680	`PF00271`	Helicase_C	304	328	0.0029	18.5
TkA04G000680	`PF30778`	SBP_bac_4HB	361	430	0.082	13.9
TkA04G000680	`PF07516`	SecA_SW	365	580	9.5e-56	189.7
TkA04G000680	`PF01043`	SecA_PP_bind	511	544	0.0022	19.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SYI0`	Arabidopsis thaliana	sp\|Q9SYI0\|SECA1_ARATH Protein translocase subunit SECA1, chloroplastic	85.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card