TkA03G606690 | RubberDandelionOmics

Gene overview

TkA03G606690

Reference: TK1151 Chr: Chr03 Coordinates: 154078135-154081005 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1533 bp · TkA03G606690|TK1151|cDNA

TCAAAACCCTCAAAAGTCTTCACATTTCAGGGACCTGCAACTGTTTTCTGTAAAGATGGGAAACAAGAGTTCAAGAGAATCTTCATCAAGAATAAGAACAGACTCCAGTCATCGATGGTCAACGAGTGCTACTTCCACACCAAGGCATCATCATGCCCCAGCTCCTTACGGATACGGGCCACCACTGGGTCATGAAAGAAGGTTGGATAGAAAGTATTCAAGAATAGCCGATGACTACGAGACACTTGAACAGGTTACTT...

CDS

Download CDS FASTA

1215 bp · TkA03G606690|TK1151|CDS

ATGGGAAACAAGAGTTCAAGAGAATCTTCATCAAGAATAAGAACAGACTCCAGTCATCGATGGTCAACGAGTGCTACTTCCACACCAAGGCATCATCATGCCCCAGCTCCTTACGGATACGGGCCACCACTGGGTCATGAAAGAAGGTTGGATAGAAAGTATTCAAGAATAGCCGATGACTACGAGACACTTGAACAGGTTACTTCGGCACTTGCTCAAGCCGGGCTCGAGTCATCGAATTTAATTGTTGGCATCGATTT...

Protein

Download Protein FASTA

404 aa · TkA03G606690|TK1151|PROTEIN

MGNKSSRESSSRIRTDSSHRWSTSATSTPRHHHAPAPYGYGPPLGHERRLDRKYSRIADDYETLEQVTSALAQAGLESSNLIVGIDFTKSNEWTGARSFNRRSLHNIGMVQNPYEQAISIIGKTLSAFDEDNMIPCFGFGDASTHDQSVFSFYPNSSSCEGFEDVLFRYRDIAPQLRLSGPTSFAPIIEMAMTIVEESGGQYHVLLIIADGQVTRSGDADFGHRELSSQERNTIDAIVKASIYPLSIILVGVGDGPWDMM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G606690`
TK1151 ID	TkA03G606690
OH-1004 ID	LXL04_011626
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G606690

Location Chr03:154078135-154081005 (+)

Description Similar to RGLG2: E3 ubiquitin-protein ligase RGLG2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14420`	E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.	Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035 Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
`At3g01650`	E3 ubiquitin-protein ligase that mediates the formation of 'Lys-63'-linked ubiquitin chains.	Ubiquitin lysine 63 chain forming ligases regulate apical dominance in Arabidopsis.2007 · DOI: 10.1105/tpc.107.052035 Arabidopsis RGLG2, functioning as a RING E3 ligase, interacts with AtERF53 and negatively regulates the plant drought stress response.2012 · DOI: 10.1104/pp.111.189738
`At1g67800`	Together with RGLG1, mediates the ubiquitination and subsequent proteasomal degradation of the target protein PP2CA.	No verified direct reference in this release
`At5g63970`	Possesses E3 ubiquitin-protein ligase in vitro.	Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422 Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068 The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122
`At1g79380`	Possesses E3 ubiquitin-protein ligase in vitro.	Two novel RING-type ubiquitin ligases, RGLG3 and RGLG4, are essential for jasmonate-mediated responses in Arabidopsis.2012 · DOI: 10.1104/pp.112.203422 Hijacking of the jasmonate pathway by the mycotoxin fumonisin B1 (FB1) to initiate programmed cell death in Arabidopsis is modulated by RGLG3 and RGLG4.2015 · DOI: 10.1093/jxb/erv068 The Arabidopsis Iron-Sulfur Protein GRXS17 is a Target of the Ubiquitin E3 Ligases RGLG3 and RGLG4.2016 · DOI: 10.1093/pcp/pcw122

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011626 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009690 cytokinin metabolic process Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009850 auxin metabolic process Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0070534 protein K63-linked ubiquitination Biological Process

GO:0080148 negative regulation of response to water deprivation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G67800

ath:AT1G79380

ath:AT3G01650

ath:AT5G14420

ath:AT5G63970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.498

Rank 1 · TkA03G606690 · TK1151

Nucleus0.404

Rank 2 · TkA03G606690 · TK1151

Cell membrane0.209

Rank 3 · TkA03G606690 · TK1151

Lysosome / Vacuole0.099

Rank 4 · TkA03G606690 · TK1151

Golgi apparatus0.056

Rank 5 · TkA03G606690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07002Copine103-319 aa

PF10138vWA-TerF-like229-284 aa

PF14447Prok-RING_4353-366 aa

PF13920zf-C3HC4_3357-397 aa

PF24921RING_XB3-XBAT31359-386 aa

PF00097zf-C3HC4360-392 aa

PF13923zf-C3HC4_2360-392 aa

PF14447Prok-RING_4360-400 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G606690	`PF07002`	Copine	103	319	5.1e-72	242.6
TkA03G606690	`PF10138`	vWA-TerF-like	229	284	0.0014	19.5
TkA03G606690	`PF14447`	Prok-RING_4	353	366	4.2	8.1
TkA03G606690	`PF13920`	zf-C3HC4_3	357	397	7.6e-06	26.4
TkA03G606690	`PF24921`	RING_XB3-XBAT31	359	386	4.1	8.2
TkA03G606690	`PF00097`	zf-C3HC4	360	392	0.0043	17.6
TkA03G606690	`PF13923`	zf-C3HC4_2	360	392	0.12	12.9
TkA03G606690	`PF14447`	Prok-RING_4	360	400	4.2	8.1
TkA03G606690	`PF13639`	zf-RING_2	360	393	7.0	7.7
TkA03G606690	`PF24921`	RING_XB3-XBAT31	388	396	4.1	8.2
TkA03G606690	`PF00097`	zf-C3HC4	389	399	0.0043	17.6
TkA03G606690	`PF13923`	zf-C3HC4_2	389	398	0.12	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LY87`	Arabidopsis thaliana	sp\|Q9LY87\|RGLG2_ARATH E3 ubiquitin-protein ligase RGLG2	66.800%	Swiss-Prot	High
`Q9SS90`	Arabidopsis thaliana	sp\|Q9SS90\|RGLG1_ARATH E3 ubiquitin-protein ligase RGLG1	68.800%	Swiss-Prot	High
`Q8LB88`	Arabidopsis thaliana	sp\|Q8LB88\|RGLG5_ARATH E3 ubiquitin-protein ligase RGLG5	66.100%	Swiss-Prot	High
`Q8RX26`	Arabidopsis thaliana	sp\|Q8RX26\|RGLG3_ARATH E3 ubiquitin-protein ligase RGLG3	59.500%	Swiss-Prot	High
`Q9SAL0`	Arabidopsis thaliana	sp\|Q9SAL0\|RGLG4_ARATH E3 ubiquitin-protein ligase RGLG4	56.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card