TkA03G518300 | RubberDandelionOmics

Gene overview

TkA03G518300

Reference: TK1151 Chr: Chr03 Coordinates: 130035012-130036622 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1098 bp · TkA03G518300|TK1151|cDNA

AAAAATCTATTTAAAGGCATGAGACTGCTTGGCAATTGGCATACCGTCCCAATCTTCTCTCCGGCAAATATCTTACTAGTTACCACTATTTTGCTTATCCACCCAAAACCATGGCAAATATTTCAGAAGTTGTCTCCAGGTTGTCAATGAAAGTAGCAATTATCACCGGCGGAGCTCAGGGAATCGGCGAGGCAACCGCCAGGCTATTCATCAAACATGGAGCCAAAGTCGTAATTGCAGATATCCAAGACCAATTAGGT...

CDS

Download CDS FASTA

816 bp · TkA03G518300|TK1151|CDS

ATGGCAAATATTTCAGAAGTTGTCTCCAGGTTGTCAATGAAAGTAGCAATTATCACCGGCGGAGCTCAGGGAATCGGCGAGGCAACCGCCAGGCTATTCATCAAACATGGAGCCAAAGTCGTAATTGCAGATATCCAAGACCAATTAGGTGAATCCGTTTGTAAAGACATGGGTATCGATAACGCTTCATTTGTCCATTGCGACGTGACAATCGAATCAGATGTTGAAAACGCCATCAACGTCACACTTGCTAAATACGG...

Protein

Download Protein FASTA

271 aa · TkA03G518300|TK1151|PROTEIN

MANISEVVSRLSMKVAIITGGAQGIGEATARLFIKHGAKVVIADIQDQLGESVCKDMGIDNASFVHCDVTIESDVENAINVTLAKYGRLDIMVNNAAIVDDGKLNILDNDLSDFERVMKVNVTGVFLGTKHAARAMIPARKGSIIILGSVSGSIGGIISHAYSSSKHAIVGLTKNTAAELGQYGIRVNCLSPHFIPSPMATNYIQDHPDKYSKVYTNLKGMLLRIEDVAEAALFLASDEARYMSGHNLVLDGGFTVINPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G518300`
TK1151 ID	TkA03G518300
OH-1004 ID	LXL04_010307
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 61.731 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G518300

Location Chr03:130035012-130036622 (-)

Description Similar to Secoisolariciresinol dehydrogenase (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0179200`	Involved in momilactone phytoalexins biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010307 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0009807 lignan biosynthetic process Biological Process

GO:0016099 monoterpenoid biosynthetic process Biological Process

GO:0044283 small molecule biosynthetic process Biological Process

GO:0046211 (+)-camphor biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0010301 xanthoxin dehydrogenase (NAD+) activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

GO:0047500 (+)-borneol dehydrogenase activity Molecular Function

KEGG gene cross-reference

ag:BAK09296

ath:AT3G51680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.558

Rank 1 · TkA03G518300 · TK1151

Peroxisome0.287

Rank 2 · TkA03G518300 · TK1151

Nucleus0.204

Rank 3 · TkA03G518300 · TK1151

Mitochondrion0.105

Rank 4 · TkA03G518300 · TK1151

Plastid0.051

Rank 5 · TkA03G518300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short14-205 aa

PF027373HCDH_N14-58 aa

PF08659KR17-172 aa

PF01370Epimerase17-102 aa

PF010733Beta_HSD17-102 aa

PF05368NmrA17-79 aa

PF13561adh_short_C222-255 aa

PF027373HCDH_N60-98 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G518300	`PF00106`	adh_short	14	205	4.7e-53	180.3
TkA03G518300	`PF02737`	3HCDH_N	14	58	0.54	10.9
TkA03G518300	`PF08659`	KR	17	172	2.1e-09	38.3
TkA03G518300	`PF01370`	Epimerase	17	102	0.0058	16.8
TkA03G518300	`PF01073`	3Beta_HSD	17	102	0.11	12.3
TkA03G518300	`PF05368`	NmrA	17	79	0.29	11.4
TkA03G518300	`PF13561`	adh_short_C2	22	255	9e-63	212.7
TkA03G518300	`PF02737`	3HCDH_N	60	98	0.54	10.9
TkA03G518300	`PF05368`	NmrA	141	177	0.29	11.4
TkA03G518300	`PF01370`	Epimerase	150	178	0.0058	16.8
TkA03G518300	`PF01370`	Epimerase	161	237	0.0058	16.8
TkA03G518300	`PF05368`	NmrA	218	242	0.29	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FAE1`	Oryza sativa subsp. japonica	sp\|Q7FAE1\|MOMAS_ORYSJ Momilactone A synthase	51.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card